ID: 1105869422

View in Genome Browser
Species Human (GRCh38)
Location 13:24491029-24491051
Sequence GAGGATCTATTGAACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85894
Summary {0: 1, 1: 9, 2: 482, 3: 9221, 4: 76181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105869422_1105869428 9 Left 1105869422 13:24491029-24491051 CCTCCTGAGTTCAATAGATCCTC 0: 1
1: 9
2: 482
3: 9221
4: 76181
Right 1105869428 13:24491061-24491083 CCTCCAGAATTGTATTTGAATGG 0: 1
1: 0
2: 1
3: 15
4: 194
1105869422_1105869429 10 Left 1105869422 13:24491029-24491051 CCTCCTGAGTTCAATAGATCCTC 0: 1
1: 9
2: 482
3: 9221
4: 76181
Right 1105869429 13:24491062-24491084 CTCCAGAATTGTATTTGAATGGG 0: 1
1: 1
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105869422 Original CRISPR GAGGATCTATTGAACTCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr