ID: 1105871939

View in Genome Browser
Species Human (GRCh38)
Location 13:24512883-24512905
Sequence CCGGAATCGGGTCCGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 29}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105871930_1105871939 6 Left 1105871930 13:24512854-24512876 CCCAAGCAGGGACGATAGCCGGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 29
1105871931_1105871939 5 Left 1105871931 13:24512855-24512877 CCAAGCAGGGACGATAGCCGGAA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 29
1105871926_1105871939 23 Left 1105871926 13:24512837-24512859 CCAGGCGGGCGCAGCGTCCCAAG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 29
1105871923_1105871939 30 Left 1105871923 13:24512830-24512852 CCCCGCACCAGGCGGGCGCAGCG 0: 1
1: 0
2: 1
3: 19
4: 125
Right 1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 29
1105871924_1105871939 29 Left 1105871924 13:24512831-24512853 CCCGCACCAGGCGGGCGCAGCGT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 29
1105871925_1105871939 28 Left 1105871925 13:24512832-24512854 CCGCACCAGGCGGGCGCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 85
Right 1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105871939 Original CRISPR CCGGAATCGGGTCCGCCAGG TGG Intergenic
900318811 1:2072520-2072542 CAGGCATTGGGTCGGCCAGGTGG + Intronic
900562170 1:3312549-3312571 CCGGATCCGGGGCCGGCAGGTGG + Intronic
900640493 1:3685948-3685970 CCGGCCTCGGGTCAGACAGGCGG + Intronic
902586189 1:17439790-17439812 CCGGCAACGGGTCCGCCGGCCGG - Intergenic
916786797 1:168092414-168092436 CTGGAAACGGGGCAGCCAGGTGG + Intronic
920037485 1:203075605-203075627 CCGGAAGCGCTTCCTCCAGGAGG - Exonic
1074121822 10:110498708-110498730 CCGGCAGCGGGTCTGCCCGGTGG + Intronic
1074950933 10:118334706-118334728 CTGGAATGGGGTCAGCGAGGAGG - Intronic
1092689525 12:11092274-11092296 CCGGAATTGGTTCCTGCAGGTGG + Exonic
1105799279 13:23889422-23889444 CCGGAAGCGGGGCCGTCACGTGG - Intergenic
1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG + Intergenic
1114452594 14:22836949-22836971 CCGGAGTCGCGCCCGCCGGGAGG + Intronic
1127763437 15:62163931-62163953 CCGGGATCGGGGCCGCCTGCTGG - Exonic
1128319087 15:66680085-66680107 CCTGAACTGGGTCCTCCAGGGGG + Intronic
1142009567 16:87706943-87706965 CCAGCACCGGCTCCGCCAGGAGG + Intronic
1143800590 17:9376851-9376873 CCGGAATTGGTTCCTTCAGGTGG - Intronic
1144958665 17:19032749-19032771 TGGGAATGGCGTCCGCCAGGCGG - Intronic
1144976494 17:19141775-19141797 TGGGAATGGCGTCCGCCAGGCGG + Intronic
1148491235 17:48025176-48025198 CCGGAGTCGGGTCCGCCCTGGGG + Intergenic
1150267851 17:63842526-63842548 CGGGGACCGGGTCCGGCAGGAGG - Exonic
1162914272 19:13865715-13865737 CCGGAGCCGGGGCCGCCAGGGGG + Intronic
1164989662 19:32674925-32674947 CCGCTCCCGGGTCCGCCAGGTGG - Intronic
1171398822 20:24858432-24858454 CCGGAATTGGTTCCTTCAGGTGG + Intergenic
1184620396 22:45672177-45672199 CCGGTAACGGGTCCGGCCGGGGG + Exonic
968904834 4:3446371-3446393 CCGGGATGGGGTCCGCAAGCGGG - Intronic
981128497 4:141132954-141132976 CCGGAATCCGGTCCCCGCGGCGG - Intronic
982036688 4:151352927-151352949 CCGGAATTGGTTCCTCCCGGTGG + Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
992173511 5:74127224-74127246 CCAGAATCATGTCTGCCAGGAGG + Intergenic
997294436 5:132760950-132760972 CCTGAAGCGGGTCCACCAGGAGG - Exonic
998366915 5:141637739-141637761 CCGGTACCGGGTCGGCCAGGTGG + Exonic
1036394923 8:8361395-8361417 CTGGGATCGGGTCCGGAAGGGGG + Intronic
1036999865 8:13705334-13705356 CCTGAAGCGGGTCCACCAGGAGG + Intergenic
1049943995 9:576869-576891 CCGGAATTGGTTCCTTCAGGTGG + Intronic
1189333798 X:40158127-40158149 CTGGGATCGGGACGGCCAGGAGG - Intronic