ID: 1105874302

View in Genome Browser
Species Human (GRCh38)
Location 13:24539825-24539847
Sequence GCACCTAGATGAAGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105874294_1105874302 10 Left 1105874294 13:24539792-24539814 CCTGCTGGCCAGCAACGTCCTCG 0: 1
1: 1
2: 2
3: 7
4: 115
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874296_1105874302 2 Left 1105874296 13:24539800-24539822 CCAGCAACGTCCTCGGCCTTTGG 0: 1
1: 1
2: 2
3: 8
4: 69
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874299_1105874302 -8 Left 1105874299 13:24539810-24539832 CCTCGGCCTTTGGGTGCACCTAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874293_1105874302 20 Left 1105874293 13:24539782-24539804 CCAGGAATTTCCTGCTGGCCAGC 0: 1
1: 1
2: 1
3: 19
4: 200
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874291_1105874302 30 Left 1105874291 13:24539772-24539794 CCTGGATGCACCAGGAATTTCCT 0: 1
1: 1
2: 0
3: 13
4: 155
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105874302 Original CRISPR GCACCTAGATGAAGTCCTGG AGG Intergenic