ID: 1105874302

View in Genome Browser
Species Human (GRCh38)
Location 13:24539825-24539847
Sequence GCACCTAGATGAAGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105874299_1105874302 -8 Left 1105874299 13:24539810-24539832 CCTCGGCCTTTGGGTGCACCTAG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874293_1105874302 20 Left 1105874293 13:24539782-24539804 CCAGGAATTTCCTGCTGGCCAGC 0: 1
1: 1
2: 1
3: 19
4: 200
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874296_1105874302 2 Left 1105874296 13:24539800-24539822 CCAGCAACGTCCTCGGCCTTTGG 0: 1
1: 1
2: 2
3: 8
4: 69
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874291_1105874302 30 Left 1105874291 13:24539772-24539794 CCTGGATGCACCAGGAATTTCCT 0: 1
1: 1
2: 0
3: 13
4: 155
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1105874294_1105874302 10 Left 1105874294 13:24539792-24539814 CCTGCTGGCCAGCAACGTCCTCG 0: 1
1: 1
2: 2
3: 7
4: 115
Right 1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105874302 Original CRISPR GCACCTAGATGAAGTCCTGG AGG Intergenic
900314283 1:2049482-2049504 GCACGTGGCTGAAGTCCTGGTGG + Intergenic
900460482 1:2800236-2800258 GCCCCGAGAGGTAGTCCTGGAGG + Intronic
901906767 1:12419140-12419162 GGATCTATATGAAGGCCTGGGGG + Intronic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
908657302 1:66401863-66401885 TCTCCTAAATGGAGTCCTGGTGG + Intergenic
913479891 1:119277936-119277958 GCACCTCCATGAAGACCTAGAGG - Intergenic
916470554 1:165118677-165118699 GCACCAAGATGAGGAGCTGGAGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
1067567175 10:47347765-47347787 GCAGCAAGAAGAAGTCCTTGGGG - Intergenic
1067670112 10:48312433-48312455 GCACCAAGAGGCAGTACTGGAGG - Intronic
1068752643 10:60612764-60612786 TCACCTAACTGAATTCCTGGTGG + Intronic
1070318386 10:75335682-75335704 CCACCTATATGATCTCCTGGTGG + Intergenic
1070843922 10:79506837-79506859 GCAGGTAGATGAGGTCCGGGAGG + Intergenic
1070843960 10:79507044-79507066 GCAGGTAGATGAGGTCCGGGAGG + Intergenic
1070844003 10:79507251-79507273 GCAGGTAGATGAGGTCCGGGAGG + Intergenic
1070844018 10:79507320-79507342 GCAGGTAGATGAGGTCCGGGAGG + Intergenic
1072150484 10:92678959-92678981 GAACTGAGATGAAGTCCTTGTGG + Intergenic
1074510239 10:114104884-114104906 GCAACTAGATCAAGTGATGGTGG + Intergenic
1077887650 11:6397609-6397631 GCACCTAGTTGGAGCCCTGAAGG - Intronic
1079028575 11:16968123-16968145 ACACCTAGATGACTTCCTGTGGG - Intronic
1079160670 11:17990412-17990434 ACACCCTGATGAAGTCCAGGAGG - Intronic
1081005515 11:37732162-37732184 GCACCTAGATGAACTTCTTCAGG + Intergenic
1084485862 11:69447837-69447859 GCACCTGGATGAGAGCCTGGTGG + Intergenic
1084681421 11:70668683-70668705 GCACCTGGAAGACTTCCTGGAGG + Intronic
1089015943 11:115165352-115165374 GCACGTAGAGCAAGTTCTGGAGG - Intergenic
1090086089 11:123652463-123652485 GCAGCTAGAGTTAGTCCTGGAGG + Intronic
1090456140 11:126851253-126851275 TCACTTAGATGATGTGCTGGTGG + Intronic
1090770067 11:129912135-129912157 GCACCTGGATGGCGTGCTGGGGG + Exonic
1090821558 11:130347039-130347061 CCACCTAGTTGAAGGCCTGAAGG + Intergenic
1091123311 11:133074987-133075009 GCACCTAGGGCAAGTACTGGGGG + Intronic
1096072445 12:48782804-48782826 CCACCCACATGGAGTCCTGGCGG + Exonic
1098398755 12:70050898-70050920 GCAACTTGATGAAGCCCTGGGGG + Intergenic
1098822740 12:75253284-75253306 GCAAAGAGATGAAGTCCTGAGGG - Intergenic
1101625880 12:106440628-106440650 ACACCTAAGTGAAGACCTGGAGG - Intronic
1105323088 13:19346042-19346064 GACCCAAGATGAAGTCCTGGAGG - Intergenic
1105874302 13:24539825-24539847 GCACCTAGATGAAGTCCTGGAGG + Intergenic
1108870450 13:54977812-54977834 GCACCTCAATGAAGTCTTTGAGG - Intergenic
1113867538 13:113537060-113537082 GCACCTGGGTGTTGTCCTGGCGG + Intronic
1116202599 14:41817746-41817768 GAACCTAGATAAACTCCGGGGGG + Intronic
1119507645 14:75186745-75186767 GCAGAGAGATGAAGTCCTAGAGG + Intergenic
1121447868 14:93989536-93989558 GCATCTGGATGAAATCCTGATGG - Intergenic
1126452413 15:48823312-48823334 GCTCCTTGATGCAGTTCTGGAGG - Intergenic
1126867627 15:52953416-52953438 CCACTTATATGAAGTACTGGAGG + Intergenic
1137737697 16:50737163-50737185 GCACCAACAAGAAGTCCTGGAGG - Intergenic
1141859144 16:86704659-86704681 GCACCTTCAGGAAGTCCAGGTGG + Intergenic
1142987838 17:3707722-3707744 GCAGCCAGTTGCAGTCCTGGGGG - Intergenic
1143811915 17:9478678-9478700 GTACCCAGATGAAGTTGTGGAGG - Intronic
1147669630 17:42169563-42169585 GCACACGGATGAAGTCCTTGAGG + Exonic
1148835237 17:50462474-50462496 GCTCCTGGATGAAGTGGTGGCGG + Exonic
1150266104 17:63833327-63833349 ATTCCTGGATGAAGTCCTGGGGG + Exonic
1150382256 17:64730034-64730056 GCACCCAGATGAGGTCCTTCAGG - Intergenic
1150774013 17:68064800-68064822 GCACCCAGATGAGGTCCTTCAGG + Intergenic
1157103604 18:44752448-44752470 TGACCTAAATGAAGTGCTGGTGG + Intronic
1158678342 18:59543218-59543240 TCACCTACATTAAGTCCAGGAGG - Intronic
1166389499 19:42401336-42401358 GTACCTGGATGAAGTCCGAGGGG + Intergenic
927220856 2:20707608-20707630 GCACCTAGCTGAAATTCAGGGGG - Intronic
929993073 2:46805761-46805783 GCACCCACATGAAGGCCTGGAGG - Intergenic
931441627 2:62294232-62294254 GCACTCAGATGCTGTCCTGGGGG + Intergenic
932106372 2:68946700-68946722 GCACCTATAAGAAGTTGTGGAGG + Intronic
946255975 2:218442114-218442136 GAACCTAGAACAAGTCATGGTGG + Intronic
946747366 2:222860016-222860038 CCACCTAGTTCAAGTTCTGGCGG + Intergenic
1170395668 20:15922661-15922683 GCACCTAATTCCAGTCCTGGAGG - Intronic
1171116492 20:22529398-22529420 GCACCTTGCAGAAGTGCTGGAGG - Intergenic
1172596977 20:36156267-36156289 GCACCTCAAGGCAGTCCTGGAGG + Intronic
1175833585 20:61979968-61979990 GCACCAACATGGAGCCCTGGGGG + Intronic
1178345304 21:31821017-31821039 CATCCTAGATGAAATCCTGGAGG + Intergenic
1179310418 21:40190747-40190769 GCACCCAGATAAAGCCCTGCTGG + Intronic
949823852 3:8143760-8143782 GCACCTAGGTAAAATCTTGGAGG - Intergenic
950901294 3:16500163-16500185 GAGCATAGATGAAGTACTGGGGG - Intronic
954414665 3:50387381-50387403 GCACAGAGATGCAGCCCTGGAGG + Intronic
954760431 3:52870010-52870032 GCAGCTAGAGGAACTGCTGGAGG + Intronic
957625529 3:82648916-82648938 TTACCTAGGTGAAGTCCAGGTGG - Intergenic
961056252 3:123791089-123791111 GCACCTAGAACAGGACCTGGAGG + Intronic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
967329454 3:188275972-188275994 GCACCTAGAAAAGTTCCTGGAGG - Intronic
969340521 4:6537907-6537929 CCACTTATATGAAGTCCTGGAGG + Intronic
972284887 4:37638605-37638627 GTTCATAGATGAAGTCCTGGGGG + Intronic
974983373 4:68989683-68989705 GCACCTAGATGAAATATTGGGGG + Intergenic
976889830 4:90033018-90033040 GCTTCTAGATAGAGTCCTGGAGG - Intergenic
985903498 5:2814907-2814929 GCACGCAGATGGACTCCTGGAGG - Intergenic
989114007 5:37934252-37934274 TCCCCTAGATGAAGTACGGGAGG + Intergenic
992098982 5:73388284-73388306 GGAGCTAGAGGAATTCCTGGGGG - Intergenic
992553198 5:77878869-77878891 GAATCTAGTTAAAGTCCTGGTGG - Intergenic
996528801 5:124505455-124505477 GCACCTGGAAGAAGTCTGGGTGG - Intergenic
998303635 5:141051782-141051804 GCACTTTGAAGTAGTCCTGGTGG + Exonic
1003800166 6:9655320-9655342 GGACCTTGATGAAGTCCTACAGG - Intronic
1004515822 6:16321506-16321528 GCACCTAGGTGGGGGCCTGGGGG + Intronic
1006058211 6:31401099-31401121 GCACACGGAGGAAGTCCTGGAGG + Intronic
1006070596 6:31495310-31495332 GCACACGGAGGAAGTCCTGGAGG + Intronic
1017266516 6:152452281-152452303 CCACCTAGATTAAATCCTAGAGG + Intronic
1024215609 7:47245875-47245897 GCTCCAACAAGAAGTCCTGGAGG - Intergenic
1026737777 7:72960017-72960039 TCACCCAGATGAACTCATGGTGG + Exonic
1026775018 7:73225995-73226017 GCACCTTGAAGAAGTCAAGGAGG - Intergenic
1027015874 7:74779366-74779388 GCACCTTGAAGAAGTCGAGGAGG - Exonic
1027072155 7:75166571-75166593 GCACCTTGAAGAAGTCGAGGAGG + Intergenic
1027105957 7:75405051-75405073 TCACCCAGATGAACTCATGGTGG - Exonic
1029876808 7:103762954-103762976 GAACCAAATTGAAGTCCTGGGGG - Intronic
1030201333 7:106908520-106908542 GCAGCTAAATGCAGTCCTGTGGG - Intergenic
1033566245 7:142580934-142580956 TCACCTAGATGAGGCCCTTGTGG - Intergenic
1034343406 7:150371835-150371857 GCACGTAGCTGAGGCCCTGGAGG + Exonic
1036171528 8:6490098-6490120 GGACCAAGTTGACGTCCTGGAGG - Intronic
1038541062 8:28390429-28390451 GCACCTAGTTCCAGTCTTGGAGG - Intronic
1039829216 8:41199734-41199756 GAACCTAAATGAACTCCAGGAGG - Intergenic
1042670590 8:71258586-71258608 GGACCTAGAAAAATTCCTGGTGG - Intronic
1045564035 8:103295522-103295544 GAACCTGGAAGAACTCCTGGAGG - Intergenic
1048477025 8:134752838-134752860 GGGCTTAGATGAAGTCCTGAGGG - Intergenic
1053108259 9:35432769-35432791 GGACATAGATGTATTCCTGGAGG - Intergenic
1060411539 9:123403487-123403509 GCACCTAGAGGAGGTACAGGGGG + Exonic
1187262646 X:17701551-17701573 TCACCCAGAAAAAGTCCTGGGGG + Intronic
1190433241 X:50398171-50398193 GCACCCAGCTGAAGTCATGAGGG - Intronic
1197815455 X:130493671-130493693 GCACCTAGATGATGCCCATGTGG + Intergenic
1202101963 Y:21318836-21318858 GCACCTACAGGAAGTGGTGGGGG + Intergenic