ID: 1105878940

View in Genome Browser
Species Human (GRCh38)
Location 13:24586554-24586576
Sequence ACAGGCGGGAGCCACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6378
Summary {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105878937_1105878940 -7 Left 1105878937 13:24586538-24586560 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878930_1105878940 6 Left 1105878930 13:24586525-24586547 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878936_1105878940 -6 Left 1105878936 13:24586537-24586559 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878925_1105878940 26 Left 1105878925 13:24586505-24586527 CCTGACGCCCAGTGATCTGCCCA 0: 2
1: 1
2: 161
3: 6136
4: 25424
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878928_1105878940 18 Left 1105878928 13:24586513-24586535 CCAGTGATCTGCCCACCTCGGCC 0: 90
1: 455
2: 1298
3: 2426
4: 3389
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878932_1105878940 3 Left 1105878932 13:24586528-24586550 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878934_1105878940 -3 Left 1105878934 13:24586534-24586556 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878927_1105878940 19 Left 1105878927 13:24586512-24586534 CCCAGTGATCTGCCCACCTCGGC 0: 74
1: 3840
2: 19098
3: 49617
4: 63448
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464
1105878929_1105878940 7 Left 1105878929 13:24586524-24586546 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1105878940 13:24586554-24586576 ACAGGCGGGAGCCACCATGATGG 0: 4
1: 8
2: 296
3: 1606
4: 4464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105878940 Original CRISPR ACAGGCGGGAGCCACCATGA TGG Intergenic
Too many off-targets to display for this crispr