ID: 1105880499

View in Genome Browser
Species Human (GRCh38)
Location 13:24601674-24601696
Sequence TACTGCCCAAAGCAATTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 13, 2: 58, 3: 158, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105880499_1105880501 20 Left 1105880499 13:24601674-24601696 CCTGTCAATTGCTTTGGGCAGTA 0: 1
1: 13
2: 58
3: 158
4: 326
Right 1105880501 13:24601717-24601739 ATTCTTCCAATCCATGAGCATGG 0: 372
1: 6047
2: 14018
3: 7321
4: 4491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105880499 Original CRISPR TACTGCCCAAAGCAATTGAC AGG (reversed) Intergenic
900038768 1:439580-439602 TACTGCCCAAAGCGATTTATAGG + Intergenic
900060202 1:674559-674581 TACTGCCCAAAGCGATTTATAGG + Intergenic
902083895 1:13841941-13841963 TACTCCCCAAAGCAATTTACAGG - Intergenic
902085584 1:13858343-13858365 TACTGCCCAAAGCAATTTACAGG - Intergenic
904382753 1:30122591-30122613 TATTGGCCAAAGCAAGTCACAGG + Intergenic
905836947 1:41133114-41133136 TACTGCCCAAAGTAATTTATAGG - Intronic
906029875 1:42710279-42710301 TATTTTCCAAAGCATTTGACAGG - Intergenic
906583935 1:46959272-46959294 TACTGCACAAAGCAATATACAGG + Intergenic
907006974 1:50924480-50924502 TACTACCCAAAGCAATCTACAGG + Intronic
907793108 1:57687458-57687480 TACTGCCCAAAGTAATCTACAGG + Intronic
908106170 1:60844594-60844616 TACTGCCCAAAGTAATTTATAGG + Intergenic
908506822 1:64811321-64811343 TACTGCAATAAGCAATTTACTGG - Intronic
909232419 1:73106563-73106585 TACTACCCAAAGCAATCTACAGG + Intergenic
909871021 1:80739252-80739274 TACTACCCAAAGCAATCTTCAGG + Intergenic
911690220 1:100824620-100824642 TACTGCCCAAAATAATTTATAGG + Intergenic
911892234 1:103386046-103386068 TACTGCCCAAAGCACTTTATAGG + Intergenic
911976357 1:104501968-104501990 TACTACCGAAAGCAATCTACAGG + Intergenic
912009032 1:104936716-104936738 TACTGCCCAAGGTAATTCATAGG - Intergenic
912611423 1:111049240-111049262 CACTGTCCAAAGCAATTTATAGG - Intergenic
912686235 1:111768270-111768292 TATTGCCCAATCCAAATGACAGG - Intergenic
913033531 1:114936963-114936985 TACTGCCCAAGGTAATTTATAGG + Intronic
913416371 1:118613245-118613267 TACTACCCAAAGCAACCTACAGG - Intergenic
913997994 1:143667222-143667244 TACAGCCCAAAGCAGTGGCCAGG - Intergenic
914444934 1:147741997-147742019 TACTGGCACATGCAATTGACTGG + Intergenic
915991806 1:160525230-160525252 TATTGCCCAAAGTAATTTATAGG - Intergenic
916287067 1:163119667-163119689 TATTACCCAAAGCAATTTAGAGG + Intronic
916848620 1:168679850-168679872 TACTGCCAAAAGTAATTTATAGG - Intergenic
917181828 1:172306447-172306469 TACTGCCCAAGGTAATTTATAGG + Intronic
918156651 1:181853645-181853667 TACTGCTCAAAGTAATTTACAGG + Intergenic
918746527 1:188208493-188208515 TACTGCCCAAAACAATCTACAGG + Intergenic
918809122 1:189092957-189092979 TGCTGCCCAAGGCAATTTATAGG - Intergenic
919560087 1:199106866-199106888 TACTGCCCAAAGTAATTTATAGG + Intergenic
919590798 1:199499404-199499426 TACTGCCCAAAGCAATCTACAGG + Intergenic
920127385 1:203704132-203704154 TACAACCCAAAGCAAGAGACAGG - Intronic
920890560 1:209981019-209981041 TACTGCCCAAAGTAATTTATAGG - Intronic
920935150 1:210425914-210425936 TACTGCTCAAAGCAATTTATAGG - Intronic
921617438 1:217286336-217286358 TACTACACAAAGCAATCTACAGG - Intergenic
921653457 1:217706277-217706299 CACTGCCCAAAGCAATTTACAGG - Intronic
922047080 1:221956294-221956316 TACTGCCCAAGGTAATTTATAGG + Intergenic
922442147 1:225664719-225664741 CACTGTCCAAAGCAAGTCACAGG - Intergenic
924398479 1:243650975-243650997 TACTGCCCAAAGTAATTTATAGG - Intronic
924401389 1:243686174-243686196 TACTGCCCAAAGTAATTTATAGG + Intronic
924490369 1:244530592-244530614 CACTACCCAAAGCAATCTACAGG - Intronic
924789215 1:247228606-247228628 TATTGTCAAAAGCAATTTACAGG + Intergenic
1064263334 10:13803932-13803954 TCCTTCCCAATGCAAATGACCGG - Intronic
1064789074 10:18935106-18935128 TACTGCCCAAAGTAATTTATAGG - Intergenic
1064933518 10:20653844-20653866 TACCGCCCAAAGTTATTTACAGG - Intergenic
1066087702 10:31987081-31987103 TACTGCCCAAAGTAATCTATAGG + Intergenic
1066165111 10:32778750-32778772 TACTGCCCAAAGCAATTTACAGG - Intronic
1066172161 10:32860979-32861001 TACTGCCCAAAGTAATTTATAGG + Intronic
1066483253 10:35818265-35818287 TACCACCCAAAGCAATATACAGG - Intergenic
1066668177 10:37807494-37807516 CACTACCCAAAGCAATCTACAGG - Intronic
1066788024 10:39027522-39027544 TACTGCCCAAGGTAATTTAGAGG + Intergenic
1068906453 10:62329668-62329690 TACTTCCCAAAGTAATCTACAGG - Intergenic
1073515072 10:104068971-104068993 TACTGCATAAAGGAATTCACTGG + Intronic
1073746537 10:106475038-106475060 TATTTCCCAAAGCAATTGAAGGG + Intergenic
1073984813 10:109195955-109195977 TACTGCCCAAAGTAATTCATAGG - Intergenic
1074627049 10:115201803-115201825 TACTGCCCAAGGTAATTTATAGG - Intronic
1074635336 10:115309346-115309368 TACTGCCCAAAACAATCTGCAGG - Intronic
1076026205 10:127115912-127115934 TAGTGGCCAAAGCAGTGGACAGG + Intronic
1076964976 11:75491-75513 TACTGCCCAAAGCGATTTATAGG + Intergenic
1077960131 11:7067274-7067296 TACTGCTCAAAGTAATTTATAGG - Intronic
1078336833 11:10470880-10470902 TACTGCCCAAAGTAATTTATAGG + Intronic
1079707682 11:23640904-23640926 TACTACCCAAAGCAATCTACAGG + Intergenic
1079924316 11:26473949-26473971 TGCTACACAAAGCATTTGACTGG - Intronic
1079956627 11:26874330-26874352 TACTGCCAAAAGCAATCTACAGG + Intergenic
1080416514 11:32074261-32074283 TACTTCCCATTGCAAATGACAGG + Intronic
1080754676 11:35185362-35185384 AACTGCCCAAAGAAATGGGCAGG + Intronic
1081143937 11:39537537-39537559 TACTACCCAAAGTAATCTACAGG - Intergenic
1081369314 11:42279850-42279872 TACTGTCAAAAGCAATCTACAGG + Intergenic
1081379825 11:42400723-42400745 TACTGCCCAAAGCAATTTATAGG + Intergenic
1082736687 11:56863861-56863883 TACTTCCAAAAGAAATTCACTGG + Intergenic
1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG + Intronic
1085489601 11:76902729-76902751 TACTGCCATATGCAATTTACTGG + Intronic
1085493212 11:76941724-76941746 TACTGCCCAAATCAATCTACAGG - Intronic
1086722666 11:90140081-90140103 AACTGCCATAAGCAATTTACTGG + Intronic
1087103816 11:94390892-94390914 TACTGCTCAAAGTAATTTATAGG + Intronic
1087406404 11:97736212-97736234 TACTGCACAAAGTAATTTATAGG + Intergenic
1087443471 11:98216444-98216466 TACTACCCAAAGAAATCTACAGG - Intergenic
1087691987 11:101331240-101331262 TACTGCCCAAAGCAATTTACAGG + Intergenic
1088086957 11:105992917-105992939 TACTGCCTAAAGCAATCTATAGG - Intergenic
1088211526 11:107462083-107462105 TACTGTCCAAAGTAATTTATAGG - Intergenic
1088236890 11:107734614-107734636 TACTGCCCAAAACAATTTGCAGG - Intergenic
1088385023 11:109244640-109244662 TCCTGCCCAAAGTAATTTATAGG + Intergenic
1089133249 11:116228908-116228930 TATTGGCCAAAGCAAGTCACAGG + Intergenic
1089594028 11:119564672-119564694 TACTGCCCAAAGCAATTTATAGG + Intergenic
1089766243 11:120768124-120768146 TACTACCCAAAGCAATACATAGG - Intronic
1089939509 11:122400818-122400840 TACTGCCCAAAGTAATTTATAGG + Intergenic
1091866991 12:3848225-3848247 TACTGCCCAAAGCAATTTACAGG + Intronic
1093403801 12:18780050-18780072 CACTGCCCAAAGTAATTTATAGG + Intergenic
1093611179 12:21160037-21160059 TACTGCCCAAAGCAATTTATAGG + Intronic
1093761000 12:22910607-22910629 TGCTACCCAAAGCAATCTACAGG + Intergenic
1094440922 12:30475880-30475902 TACTACCGAAAGCAATCTACAGG + Intergenic
1094730456 12:33168671-33168693 TACTACCCAAAGTAATTTAAAGG + Intergenic
1095400277 12:41806681-41806703 TACTGCCCAAAGCAATCTACAGG - Intergenic
1096591318 12:52661331-52661353 TACTGCTATAAGCAATTTACTGG + Intergenic
1097357319 12:58616209-58616231 TACTGCCCAAAGCATTCCAGAGG - Intronic
1097525118 12:60724227-60724249 TACTACCCAAAGCAATTTACTGG - Intergenic
1098667084 12:73177906-73177928 TACTACCCAAGGCAATCTACAGG - Intergenic
1099421315 12:82464684-82464706 TACTACCCAAAGCAATGTACAGG - Intronic
1099587616 12:84540848-84540870 TGCTGCCCAAGGCAATTTATAGG - Intergenic
1099635447 12:85206048-85206070 TGCTGACCAAAGCATTTGTCAGG + Intronic
1100670309 12:96804684-96804706 TACTGCCCAAAGCAATCTACAGG + Intronic
1101459428 12:104874914-104874936 TACTACCCAAAGCAATATACAGG - Intronic
1104150895 12:126082020-126082042 TACTGCCCAAAGTAATTTATAGG + Intergenic
1104577618 12:129982269-129982291 TACTACCGAAAGAAATTGAATGG + Intergenic
1105612342 13:21979564-21979586 TACTGCGAAATGCAATTTACTGG + Intergenic
1105649760 13:22363182-22363204 TACTGCCCAAAGCAATTAATAGG + Intergenic
1105880499 13:24601674-24601696 TACTGCCCAAAGCAATTGACAGG - Intergenic
1106896275 13:34305909-34305931 TACTACCCAAAGCAATCTATAGG + Intergenic
1107563043 13:41574491-41574513 TACTGCCCAAAGCAATCAACAGG + Intronic
1108228480 13:48315110-48315132 CACTGCCCAAAGCAATTTACAGG - Intronic
1108868788 13:54956532-54956554 TACTACCCAAAGCAATCTACAGG - Intergenic
1109333545 13:60962347-60962369 TACTACCAAAAGCAATCTACAGG - Intergenic
1109685425 13:65813190-65813212 TGGTGCCCAGAGCAACTGACTGG + Intergenic
1109910387 13:68903694-68903716 TACTATCCAAAACAATTTACAGG - Intergenic
1110122482 13:71900306-71900328 TACTGCCCACAGTAAAGGACTGG + Intergenic
1110498353 13:76195949-76195971 TACTGCCCAGAGCAATTTACAGG + Intergenic
1110541083 13:76707690-76707712 TATTGGCCAAAGCAAATTACAGG + Intergenic
1110627946 13:77672598-77672620 TACTTCCAAAAGCAATCTACAGG + Intergenic
1110876442 13:80516709-80516731 TATTGCCCAAAGCAGTCTACAGG - Intergenic
1111029518 13:82576723-82576745 TACAGCCCAAAGAAATTTACAGG - Intergenic
1111348216 13:86992812-86992834 TACTGCCTAAAGCAATCTACAGG + Intergenic
1111819834 13:93199127-93199149 TACTGCCTAAAGCAATCTATAGG + Intergenic
1112021523 13:95375419-95375441 TACTGCCCAAAGCAATCTACAGG + Intergenic
1112250761 13:97777241-97777263 TACTGCCAAAAGGAATCTACAGG - Intergenic
1112542117 13:100324835-100324857 TACTGCCATATGCAATTTACTGG - Intronic
1112663400 13:101540626-101540648 TACTGCCCAAAGTAATTTATAGG - Intronic
1114971497 14:28035277-28035299 TTCTGCCCAAAGTAATTTATGGG + Intergenic
1115168702 14:30478468-30478490 TACTGCCCAAGGTAATTTATAGG + Intergenic
1115973977 14:38976761-38976783 TACTGCCCAAAGTAATTTATAGG - Intergenic
1116140301 14:40984817-40984839 TACTACCCAATGCAATCTACAGG - Intergenic
1116209412 14:41914317-41914339 TACCACCCAAAGCAATGTACAGG - Intergenic
1116497391 14:45578150-45578172 TACTACCCAAAGCAATCTACAGG - Intergenic
1116782868 14:49255475-49255497 TACTGTCCAAAGCAATTAACAGG + Intergenic
1116902324 14:50373107-50373129 TACTACCCAAAGCAATCTACAGG - Intronic
1117004570 14:51406394-51406416 TATTGCCCACAGCAATTTACAGG - Intergenic
1117245124 14:53877054-53877076 TACTGCCCGAAGTAATTTATAGG + Intergenic
1117821159 14:59650825-59650847 TACTGGCCAAAGAAATTTATAGG + Intronic
1117953670 14:61106798-61106820 TTCTGGCCAAAGAAATTTACAGG - Intergenic
1119605921 14:76016627-76016649 TACTACCCAAAGGAATCTACAGG - Intronic
1123462643 15:20487598-20487620 TACTACCCAAAGCAATCTACAGG - Intergenic
1123655417 15:22512804-22512826 TACTACCCAAAGCAATCTACAGG + Intergenic
1124273330 15:28303621-28303643 TACTACCCAAAGCAATCTACAGG - Intronic
1124309325 15:28607999-28608021 TACTACCCAAAGCAATCTACAGG + Intergenic
1125044114 15:35226749-35226771 GACTACCCAAAGCAATCTACAGG + Intronic
1125622463 15:41076018-41076040 TACTCCCCAAAACAATCTACAGG + Intronic
1125867504 15:43066534-43066556 TACTGCCCAAAGTAATTTTTAGG - Intronic
1126306314 15:47262254-47262276 TACTGCCCAAAGCAATTTATAGG + Intronic
1127212924 15:56793370-56793392 TACTGCCCAAAGCAATCTATAGG + Intronic
1129046675 15:72741311-72741333 TACTGCCAAAAGCAATCTAGAGG + Intergenic
1129511245 15:76124461-76124483 TACTGCCCAAAGCAATCTATAGG + Intronic
1129589926 15:76905701-76905723 TGCTGGCGAAAGCACTTGACAGG + Intergenic
1129621578 15:77152060-77152082 TACTGCCCAAGGTAATTTATAGG - Intronic
1130177153 15:81585416-81585438 TACTGCCCAAAGTAATTTAGAGG + Intergenic
1130885008 15:88085332-88085354 CATTGCCCAAAGCAAGTCACTGG - Intronic
1131031066 15:89186313-89186335 CACTGCTCTAAGCACTTGACAGG - Intronic
1131591263 15:93751226-93751248 TATTGCCTAAAGCAATTTATCGG + Intergenic
1132443147 15:101888025-101888047 TACTGCCCAAAGTGATTTATAGG - Intergenic
1134898377 16:17910964-17910986 TACTGCCCAAGGTAATTTATAGG + Intergenic
1135146557 16:19967653-19967675 CACTGGCCAAAGCAAGTCACAGG - Intergenic
1135292754 16:21254268-21254290 TGGTGCCCAAAGCAATGGTCTGG - Intronic
1137925008 16:52532289-52532311 TACTGGCTAAAGCAAGTCACTGG - Intronic
1138792835 16:59928024-59928046 TACTACCTAAAGCAATCCACAGG - Intergenic
1138906184 16:61337664-61337686 TACTGCCCAAAGCAATTTACAGG + Intergenic
1139253769 16:65521401-65521423 TACTGACCAAAGCAAGAGGCTGG + Intergenic
1140465816 16:75181492-75181514 CACTGTCCAAAGCAATCTACAGG + Intergenic
1143983112 17:10887601-10887623 TACCGCCCAAAGCAATTTACAGG - Intergenic
1149194771 17:54106437-54106459 TAATACGCAAAGCAATTTACAGG + Intergenic
1150176185 17:63059011-63059033 TACTGCCCAAAGCAATTTACAGG - Intronic
1151211097 17:72544478-72544500 TTCTGCCCAAGGTAATTTACAGG - Intergenic
1152102069 17:78307845-78307867 AACTGCCCGAAGCAATTAGCAGG + Intergenic
1153074921 18:1151127-1151149 TACTACCCAAAGGAATCTACAGG - Intergenic
1153080092 18:1212599-1212621 TACTACCCAAAGCATTCTACAGG - Intergenic
1154371813 18:13770312-13770334 TACTGCCCAAAGCAATTTACAGG + Intergenic
1155745635 18:29354030-29354052 TACTCTGCAAAGCAATTTACAGG - Intergenic
1157988007 18:52461983-52462005 TTTTGCCCTAAGCAATTGAAAGG - Intronic
1158095329 18:53763715-53763737 TACTCCCCAAAGCAAATGCATGG + Intergenic
1158143946 18:54289396-54289418 TACTGCCCAAAGTAATTTATAGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159394375 18:67837324-67837346 TACTACCCAAAGCAATCTATAGG - Intergenic
1159419030 18:68191617-68191639 TACTGCCCAGAGCAATTTACAGG - Intergenic
1160641781 19:145121-145143 TACTGCCCAAAGCGATTTATAGG + Intergenic
1161195213 19:2982835-2982857 CTCTGTCCAAAGCAACTGACCGG - Intronic
1164163358 19:22646093-22646115 TACTGCCCAAAGTAATTTATGGG - Intronic
1165877389 19:39018420-39018442 TACTGCGCTATGCAATTTACTGG - Intronic
1166759728 19:45217225-45217247 CACTGTCCAAAGCACTTAACAGG + Intronic
1168074605 19:53973054-53973076 TACTGCTCCAAGCATTTGACAGG - Intronic
1168476390 19:56678506-56678528 TACTGGCCAAAGCAAACCACAGG + Intergenic
925017256 2:539978-540000 CACTGCCCAAAGTGATTTACAGG + Intergenic
925588704 2:5488657-5488679 TACTACCCAAAACAATCTACAGG + Intergenic
926773207 2:16396603-16396625 TAATGCAAAAAGCAAATGACAGG + Intergenic
926833599 2:16992310-16992332 TACTCCCCAAAGCAATCTACAGG - Intergenic
926966393 2:18418222-18418244 TACTACCCAAAGTAATCTACAGG + Intergenic
927020913 2:19016118-19016140 TACTGCCCAAGGTAATTTATAGG - Intergenic
927925286 2:27008610-27008632 TCCTGCCCTAAGCAAATGCCTGG + Intronic
928354142 2:30593620-30593642 TATTACCCAAAGCAATTTGCAGG - Intronic
928608800 2:32970828-32970850 TACTGCCCAAAGCAATTTACAGG - Intronic
929752192 2:44727191-44727213 TACTGCCCAAAGCAATTTACAGG - Intronic
930267250 2:49214331-49214353 TGCTGCCCAAAGTAATTGATAGG + Intergenic
930440301 2:51396037-51396059 TACTGCCCAAAGTATTTTATAGG + Intergenic
930567564 2:53041828-53041850 TACTGCCCAAAGCAATATATAGG - Intergenic
931098899 2:58973365-58973387 TTCTGCCTAAAGCAATAGGCAGG + Intergenic
932176627 2:69609034-69609056 TACTATCCAAAGCAATCTACAGG + Intronic
932318921 2:70806236-70806258 TACTGCCATATGCAATTTACTGG - Intergenic
932871019 2:75398141-75398163 TACTGCCCAAAGGAATCTGCAGG + Intergenic
933100245 2:78246624-78246646 TGCTGCCCAAAGTAATTTATAGG + Intergenic
933512550 2:83259466-83259488 TACTGCCCAAAGCAACTTACAGG + Intergenic
934114891 2:88778656-88778678 TACTGCCCAAAGTAATTTATAGG + Intergenic
934631758 2:95933348-95933370 TACTGCCCAAAGTAATTTATAGG - Intronic
934634112 2:95966736-95966758 TACTGCCCAAAGTAATTTGTAGG - Intronic
934799520 2:97138503-97138525 TACTGCCCAAAGTAATTTGTAGG + Intronic
934801742 2:97169850-97169872 TACTGCCCAAAGTAATTTATAGG + Intronic
934833924 2:97564945-97564967 TACTGCCCAAAGTAATTTGTAGG - Intronic
935161541 2:100533576-100533598 CACTGGCCAGAGCAAGTGACAGG - Intergenic
935749345 2:106217015-106217037 TACTACTCAAAGCAATCTACAGG + Intergenic
936120538 2:109739312-109739334 TACTACCCAAAGCAATCTACAGG - Intergenic
936121950 2:109754294-109754316 TACTACTCAAAGCAATCTACAGG - Intergenic
936222745 2:110617178-110617200 TACTACTCAAAGCAATCTACAGG + Intergenic
936224157 2:110632134-110632156 TACTACCCAAAGCAATCTACAGG + Intergenic
936786210 2:116096581-116096603 TAGTGCCCAAAGCAACAGAGTGG + Intergenic
938602242 2:132854300-132854322 TCATTCCCAAAGCAATTGAGGGG - Intronic
938632685 2:133185536-133185558 TACTGCCCAAAGCAATTTATAGG - Intronic
938867349 2:135436682-135436704 TACTGCCCAAAACAATGTACAGG + Intronic
939043111 2:137216229-137216251 TTCTGCCAAAAGCAGTTGTCAGG + Intronic
939234845 2:139477771-139477793 TACAGCTCAAAGAAATTCACAGG - Intergenic
939376221 2:141371446-141371468 TATTGCTCAAAGCAATCTACAGG - Intronic
939546099 2:143555262-143555284 GACTTCCCAAAGCACTTTACTGG - Intronic
939662962 2:144913228-144913250 TACTGCCCAAAGCAATCTACAGG - Intergenic
940077018 2:149753617-149753639 TACTGCCCAAAGTAATTTATAGG + Intergenic
940196992 2:151105715-151105737 TACTGACCAAAGCAAATCACAGG - Intergenic
941041050 2:160624165-160624187 TACTGCCTAAAGTAATTTATAGG - Intergenic
941076826 2:161014860-161014882 TACTGCCCAAAGTAATTTATAGG + Intergenic
941116221 2:161475391-161475413 TACTGCCCAAAGTAATTTATAGG + Intronic
941117164 2:161485472-161485494 TACTGCCCAAAGCAATCTACAGG + Intronic
941137526 2:161736176-161736198 TATTGCCCTAAGTAATTGATAGG + Intronic
941500337 2:166266634-166266656 TATTACCCAAAGCAATCTACAGG - Intronic
941535070 2:166712121-166712143 TAATGCCCAAAGTGATTTACAGG - Intergenic
941704847 2:168647104-168647126 CACTGCCCAAATCAATTTACCGG - Intronic
942851247 2:180489681-180489703 TACTGCCCAAAACTATCTACAGG - Intergenic
943912536 2:193586684-193586706 TACTGCCCAAAGCGATCCACAGG - Intergenic
943951845 2:194139455-194139477 CACTGGCCAAAGGAATTCACTGG + Intergenic
944585502 2:201169029-201169051 TACTACCCAAAGTAATTTATAGG + Exonic
944922148 2:204426403-204426425 GACTGCCCAAAGCAATTCACAGG + Intergenic
947091182 2:226512887-226512909 TCCTCCCCCAAGCAACTGACAGG + Intergenic
947485396 2:230543727-230543749 TACTGCCCAAAGCAGTTTACAGG + Intronic
947940306 2:234048507-234048529 TTCAGCCAAAGGCAATTGACTGG - Intergenic
1169252362 20:4070395-4070417 TATGGCCCAAAGCAAGTGACAGG - Intronic
1169502204 20:6171538-6171560 TACTGGACAAAGCAAGTCACAGG + Intergenic
1169737264 20:8850447-8850469 AACTTCCCAAGGCAGTTGACTGG + Intronic
1169757550 20:9059469-9059491 TTTTGCCCAAAGCAAGTCACTGG - Intergenic
1169876615 20:10304810-10304832 TACTGCACTATGCAATTTACTGG + Intronic
1170081284 20:12479527-12479549 TACTGCCCAAGGTAATTTATAGG + Intergenic
1170378659 20:15731607-15731629 TACTGACCAAAGCACTTCACTGG + Intronic
1171026940 20:21639401-21639423 TACTGATCAAAGCAAGTCACAGG - Intergenic
1172317078 20:33964201-33964223 TATTGACCAAAGCAAGTCACAGG + Intergenic
1173369435 20:42421623-42421645 TACTACCCAAAGCAATTTATAGG + Intronic
1173395342 20:42673972-42673994 TTCTGCCCAGAGGAATTTACAGG - Intronic
1173675353 20:44829905-44829927 TACTGCCACAGGCAATTTACTGG + Intergenic
1174746351 20:53067101-53067123 AACGGACCAAAGCAATTCACTGG - Intronic
1174885746 20:54331944-54331966 TACTGCTCTAAGAAATTAACAGG + Intergenic
1175023929 20:55881214-55881236 AAATGCCTAAAGCAATTGAGCGG - Intergenic
1177040263 21:16100199-16100221 TACTACCCAAAGCAATCTGCAGG - Intergenic
1177118314 21:17111334-17111356 TACTTCCCAAAGTAATTTATAGG + Intergenic
1177718560 21:24873498-24873520 TACTGACCAAAGCACTCTACAGG - Intergenic
1178427354 21:32489670-32489692 TACTGCCCAAAGTGATCTACAGG - Intronic
1178956309 21:37025167-37025189 TACTGCCCAAAGCAATTTCTAGG - Intergenic
1182388513 22:29969330-29969352 TACTGCCCATAGGATTTGAGTGG - Intronic
1182643174 22:31785534-31785556 TACTACCCAAAGCAGTTTACAGG + Intronic
1184307015 22:43611180-43611202 TGCTGTCCAAAGCAATTTACAGG - Intronic
949229933 3:1738775-1738797 TACGGCCCAAAGCAATCTGCAGG - Intergenic
949266627 3:2164293-2164315 TACTGACCAAATTAATTAACTGG + Intronic
949620284 3:5803148-5803170 TACTGCCCAAGGTCATTTACAGG - Intergenic
949940292 3:9149514-9149536 TACTGGGCAAAGCAAGTCACAGG - Intronic
950541445 3:13615633-13615655 CACTGCCAAAAGCCCTTGACAGG - Intronic
950596077 3:13983345-13983367 TACTATCCAAAGCAATCCACAGG - Intronic
951518033 3:23583501-23583523 TACTGCCCAAAGCAATTTACAGG - Intronic
951623616 3:24634833-24634855 TACTGCCCAAAGTAATTTATAGG - Intergenic
951861605 3:27259791-27259813 TACTGCCCAAGGTAATTTATAGG - Intronic
952016344 3:28961284-28961306 TACTGCCCAAGGTAATTTATAGG + Intergenic
952273275 3:31853011-31853033 TACTGCCCAATGCAATGCACTGG + Intronic
952550698 3:34473189-34473211 TATTGCCCAAAGTAATTTATAGG - Intergenic
952940224 3:38438425-38438447 TATTGCCCAAAGCAATCTACAGG + Intergenic
953491618 3:43357366-43357388 TACTGTCCAATGCAATTTACAGG + Intronic
953630604 3:44613226-44613248 TACTACCTAAAGCAATTTACAGG + Intronic
955249682 3:57267082-57267104 TATTGCCCAAAGCAATCTATAGG - Intronic
955538269 3:59947764-59947786 TGCTGGCCAAAGCACTTCACTGG + Intronic
955550847 3:60083521-60083543 TGTTGCCCAAAGCAATATACAGG - Intronic
955568235 3:60272864-60272886 TACTAACAAAAGCAAGTGACTGG + Intronic
955616693 3:60815804-60815826 TACTGCCCAAAATAATCTACAGG - Intronic
955680932 3:61501095-61501117 TATCGCCCAAAGCAATTTATAGG - Intergenic
957108189 3:75918606-75918628 TATTGCCCAAAGTAATTTATAGG - Intronic
957143872 3:76396892-76396914 TACTGCCCAAGGTAATTTATAGG + Intronic
957275852 3:78090630-78090652 TACTGGTCAAAGCAAGTCACAGG + Intergenic
957464026 3:80562276-80562298 TACTGCTCAAAACAATTTACAGG + Intergenic
957890375 3:86349740-86349762 TACTAACCAAAGCAATCTACAGG - Intergenic
957925969 3:86811935-86811957 TACCACCCAAAGCAATCTACAGG + Intergenic
958068027 3:88570556-88570578 TACTACCCAAAGCAATCTACAGG + Intergenic
958635430 3:96738519-96738541 TACTGCCCAAGGTAATTGACAGG + Intergenic
958875468 3:99611368-99611390 TACTGCCCAAAGCAATGTACAGG - Intergenic
958996267 3:100908826-100908848 TACTGCTCAAAGTAATTTATAGG + Intronic
959278606 3:104308864-104308886 TACTGCCCAAAGTAATTTATAGG + Intergenic
959290299 3:104465410-104465432 TACTGCCCAAGGTAATTTATAGG - Intergenic
959740278 3:109710755-109710777 TACTGCCCAAGGTAATTTATAGG + Intergenic
960118897 3:113926943-113926965 TGCTGGCCAAAGCAATTCACTGG + Intronic
960481263 3:118192757-118192779 TAATTCCCAAAGCAATTTACAGG - Intergenic
960596504 3:119412469-119412491 TAAGGCCCAAAGCTATAGACAGG - Intronic
962211717 3:133485155-133485177 TACTACCCAAAGCAATTTACAGG - Intergenic
962628715 3:137253881-137253903 TACTACCCAAAGCCATATACAGG + Intergenic
962861212 3:139404069-139404091 TGCTGCCAAAAGCAATCTACAGG - Intergenic
962935135 3:140073797-140073819 TACAGCCAAAAGAAAGTGACTGG + Intronic
963516163 3:146311262-146311284 TAGTGCCCAAAGCAATCTACAGG - Intergenic
963830084 3:149997939-149997961 TGCTGCCCAAAGCAATCTACAGG + Intronic
963910926 3:150817636-150817658 TACTGCCCAAGGGAATTTATAGG - Intergenic
963979660 3:151523235-151523257 TACTGCCCAAAGCAACTCATAGG + Intergenic
964134149 3:153325620-153325642 TACTGCCCAAAGCAACTTGCAGG - Intergenic
964196713 3:154073709-154073731 TACTGCCCAAATAAATATACAGG + Intergenic
964486900 3:157195123-157195145 TACTGCCCAAAGAAATTTACAGG + Intergenic
964519467 3:157547632-157547654 TACTGCCCCAAGCAATTTACAGG - Intronic
964565248 3:158043545-158043567 TACTGCCCAAACCAATCTACAGG + Intergenic
964723211 3:159788538-159788560 TATTGCCCAAAGGAATTCAGTGG + Intronic
964953098 3:162321716-162321738 TACTACCCAAAGCAATCTTCAGG - Intergenic
966080657 3:175996003-175996025 TAATGCCCAAAGTTATTTACAGG - Intergenic
968618664 4:1593645-1593667 TACTGTCGACAGCAATAGACAGG + Intergenic
970014710 4:11500447-11500469 TACTGCCCAAGGCAATTTATAGG - Intergenic
970985807 4:22156350-22156372 TGTTGCCCAAAGCAACTTACTGG - Intergenic
971388867 4:26167288-26167310 CACTGCCCAAGGTAATTGATAGG - Intronic
971429647 4:26552129-26552151 CACTGCCCAAAGTAATTTATAGG - Intergenic
971575827 4:28273335-28273357 TACTGCCCAAAGTAATGTATAGG - Intergenic
972689336 4:41381593-41381615 TACTGGCCAAAGCAAGTCAGAGG - Intronic
974100618 4:57412003-57412025 TTCTATCCAAAGCTATTGACGGG - Intergenic
974281496 4:59800829-59800851 TACAGCCCAAAACAATTTATAGG - Intergenic
974359037 4:60852190-60852212 TAATGCCCAAAGTAATTTATAGG + Intergenic
974782622 4:66573155-66573177 TACTCACCAATGTAATTGACTGG + Intergenic
974910724 4:68116414-68116436 TACTACCCAAAGCAATCTACAGG + Intronic
974969436 4:68805920-68805942 TACTGCCCACAGTAATTTACTGG + Intergenic
975055910 4:69928730-69928752 TAATGCCCAAGGTAATTTACAGG - Intergenic
975276711 4:72510680-72510702 TACTACCCAAAGCAATCTATAGG + Intronic
975396492 4:73880088-73880110 TACTGCCCAAAGCAATTTATAGG - Intergenic
976227499 4:82807132-82807154 TACTACCCAAAGCAATCTACAGG + Intergenic
977109681 4:92937780-92937802 TACTACCAAAAGCAATCTACAGG - Intronic
977426538 4:96873753-96873775 TACTGCACAAACCAATTCTCTGG + Intergenic
978051287 4:104203443-104203465 TACTGCCCAAAGTAATTTATAGG + Intergenic
978994678 4:115135888-115135910 TACTGCCCAAAGCAATCTACAGG + Intergenic
979003416 4:115257380-115257402 TTTTTCCCAAAGCAATTTACAGG + Intergenic
979087693 4:116434458-116434480 TACTGCCCAAAGTAATTTATAGG - Intergenic
979487875 4:121289350-121289372 TACTACCCAAAGTAATTTACAGG + Intergenic
980665653 4:135930342-135930364 TACAGCACAAAGCAATTTATAGG + Intergenic
980803947 4:137788213-137788235 TACTGCCCAACGTAATTTATAGG + Intergenic
980837165 4:138209812-138209834 TACTGCCCAAAGCAATATACAGG + Intronic
981865945 4:149419059-149419081 TACTGCCCAAAGTAATTTAGAGG + Intergenic
982860075 4:160437416-160437438 TACTGCCCAAGGTAATTTATAGG + Intergenic
983469475 4:168138665-168138687 TACTATCCAAAGCAATTTACAGG - Intronic
983714177 4:170756791-170756813 ACCTGCCCAAAGAAATTCACAGG - Intergenic
983791308 4:171800830-171800852 TGCTGCCCAAAGTAATTTATAGG - Intergenic
984409228 4:179373712-179373734 TACTGCCATATGCAATTTACTGG - Intergenic
984986813 4:185339040-185339062 TACTACCAAAAGCAATCTACAGG - Intronic
985077533 4:186231201-186231223 TACTGCCCCAGGGAATGGACAGG + Intronic
986399872 5:7370355-7370377 TACTGCACAAAGCAAATGCAAGG - Intergenic
987120738 5:14764244-14764266 TACTGACCAAAACAAATCACTGG - Intronic
987279330 5:16396554-16396576 TACTGCCCAAGGTAATTTATAGG - Intergenic
987298984 5:16580222-16580244 TACTGATCAAAGCTATTGATCGG + Intronic
987464932 5:18260749-18260771 TACTGCCCAAGGTAATTTATAGG - Intergenic
987529265 5:19095993-19096015 TACTGCCCAAAGTAATTTATAGG - Intergenic
987844586 5:23266022-23266044 TACTGCCCATATCAATTATCAGG - Intergenic
987988123 5:25176662-25176684 TACTGCCCAAAGTAATTTATAGG - Intergenic
988268294 5:28980865-28980887 CACTGTCCAAAACCATTGACAGG - Intergenic
988667353 5:33343676-33343698 TATTGCCCAAAGTAATTTATAGG + Intergenic
989244548 5:39239729-39239751 TACTGTCCAAAGCAATTTGCAGG + Intronic
990125658 5:52514708-52514730 TACTGCCCAAAGCAATCTACAGG + Intergenic
990988271 5:61660992-61661014 TAATGGCCCAAGCAATAGACTGG - Intronic
991151884 5:63380378-63380400 TACTGCCCAAAGTAATTTATAGG + Intergenic
991238706 5:64430952-64430974 TACTACCCAAAGCTATTAACAGG + Intergenic
991367982 5:65888487-65888509 TACTGTCCAAAAAAATTGAGTGG + Intergenic
991458302 5:66828492-66828514 TACTGCCGAAAGCCATTTAGTGG + Intronic
992434822 5:76745943-76745965 TACTGACCAAAGCAAGACACAGG + Intergenic
992652252 5:78871234-78871256 TACTGCCCAAGGTAATTTACAGG + Intronic
993119566 5:83758038-83758060 CACTGCCCAAAGTAATTTATAGG + Intergenic
993774841 5:91980576-91980598 TACTAGAGAAAGCAATTGACTGG - Intergenic
993793277 5:92233743-92233765 CAGTGCCTAAAGCAATTAACAGG - Intergenic
993797455 5:92284938-92284960 TATTGCCCAAAGGAATTTATAGG + Intergenic
994381279 5:99074554-99074576 TACTGACCAAAGCAATATACAGG - Intergenic
994596030 5:101836123-101836145 AATTGCCCAAAGAAATTTACAGG - Intergenic
994645946 5:102469234-102469256 TACTGCCCAAGGTAATTTATAGG - Intronic
995343522 5:111086454-111086476 TACTGCCCAAGGTAATTTACAGG - Intergenic
995923322 5:117339826-117339848 TACTGCCCAAGGTAATTTACAGG - Intergenic
995957825 5:117800925-117800947 TAGTGCCCAGAGCAATTTACAGG + Intergenic
995961117 5:117840942-117840964 TACTGCCCAAAGCAATTTACAGG + Intergenic
996024951 5:118634896-118634918 TACTGCCCAAAGAAATCTACAGG + Intergenic
996455452 5:123676135-123676157 TACTGCCCAAGGTAATTTATAGG - Intergenic
997017783 5:129957037-129957059 TACTGCACAAAACAATTTATAGG - Intronic
998577322 5:143330873-143330895 TACTGCCCAAAGCAATTAGCGGG + Intronic
998674461 5:144391360-144391382 CTCTGCCCAAAGGAATTGATCGG - Intronic
998751693 5:145329352-145329374 TACTGCCCAAAGTAATTTACAGG - Intergenic
998779728 5:145643088-145643110 TACTGCCCAAAGTAATTTATAGG - Intronic
1000797942 5:165688991-165689013 TACTGCCCAAAGTAATTTACAGG - Intergenic
1002735079 5:181379363-181379385 TACTGCCCAAAGCGATTTATAGG - Intergenic
1002749447 6:94759-94781 TACTGCCCAAAGCGATTTATAGG + Intergenic
1003001649 6:2341195-2341217 TACTACCCAAAGCAATCTACAGG + Intergenic
1003616862 6:7662605-7662627 TACTGCTCTAAGCAATTTACAGG + Intergenic
1003658461 6:8037539-8037561 TAATACCCAAAGCAATTTACAGG + Intronic
1005518830 6:26580357-26580379 TACTACTCAAAGCACTTTACAGG - Intergenic
1006274514 6:32991768-32991790 TACTGCCCAAAGCAATCTACAGG - Intergenic
1010438868 6:75869474-75869496 TACTGCTCAAAGCTTTTCACAGG - Intronic
1010465131 6:76158673-76158695 TACTGCCCAAAGTAATTTATAGG - Intergenic
1010493626 6:76504804-76504826 TACTGCCCAAAGTAATTTATAGG - Intergenic
1010820936 6:80414827-80414849 AACAGCCCAAAGCAATTTAAAGG - Intergenic
1010961988 6:82155808-82155830 TACTGCCCAAGGTAATTTATAGG + Intergenic
1011782665 6:90807703-90807725 TACTGGCCAAAGGAAGTGGCTGG + Intergenic
1012772667 6:103459670-103459692 TACTGCCCAAGGTAATTTATAGG - Intergenic
1013318406 6:108963464-108963486 TACTGCCCAACCCAGTTAACAGG + Intronic
1013871382 6:114765639-114765661 TACAACCCAAAGCAATCTACAGG - Intergenic
1015471236 6:133608916-133608938 TACTGCAAAATGCAATTTACTGG + Intergenic
1015513703 6:134064136-134064158 AACTGCACAAAGCAGTTGACAGG - Intergenic
1016073949 6:139774318-139774340 CACAGACCAAGGCAATTGACTGG - Intergenic
1016186673 6:141206143-141206165 TACTGCCCAAGGTAATTTATAGG - Intergenic
1016453240 6:144205302-144205324 TACAGCCCCAAGCAATTTACAGG - Intergenic
1016570198 6:145503662-145503684 TACTGCCCAAGGTAATTTACAGG + Intronic
1017601664 6:156090038-156090060 TACTGTCCTAAGCAATTTATAGG + Intergenic
1018448308 6:163879089-163879111 TATTGGCCAAAGCAAGTCACAGG + Intergenic
1018917222 6:168141665-168141687 TACTACCCAAAGCAATCTACAGG - Intergenic
1019098270 6:169605529-169605551 TACTGCCCAAAGCAATCCATAGG + Intronic
1019239338 6:170651680-170651702 TACTGCCCAAAGCGATTTATAGG - Intergenic
1020620171 7:10507567-10507589 TACTGCCCAAAGTAATTTACAGG + Intergenic
1020735036 7:11937735-11937757 TACTGCCCAAAGCAATCTACAGG + Intergenic
1020740464 7:12009768-12009790 CCCTACCCAAAGCAATTGATAGG + Intergenic
1022997045 7:35767465-35767487 TACTGCCCAAAGTAATTTATAGG - Intergenic
1023185323 7:37527174-37527196 TATTACCCTAAGCAATTTACAGG + Intergenic
1023211722 7:37812985-37813007 TAATGCCCAAAGCAATTTATAGG + Intronic
1023666930 7:42533043-42533065 CACTGCCCAAAGCAATTTATAGG + Intergenic
1027667308 7:81056116-81056138 TACTGCCCAAGGTAATTTATAGG + Intergenic
1027949499 7:84796310-84796332 TACTGCCTAAAACAATTTATAGG - Intergenic
1028080701 7:86571747-86571769 TACTGCCCAAAGTAATTTATAGG + Intergenic
1028413363 7:90554703-90554725 TACTGCCCAAAGCAATCTATAGG + Intronic
1028733954 7:94185639-94185661 TACTATCCAAAGCAACTTACAGG - Intergenic
1029287611 7:99476731-99476753 TACTGCACAAAGGACTTCACAGG - Intronic
1030500383 7:110352352-110352374 GACTGCCCAAAATAATTGATAGG - Intergenic
1031722281 7:125192101-125192123 TACTACCCAAAGCAAGCTACAGG + Intergenic
1031888687 7:127268472-127268494 TAGTGTCCTAAGCAATTTACAGG - Intergenic
1031892923 7:127315809-127315831 TACTGCTCAAAGCAATTTACAGG + Intergenic
1033939230 7:146630977-146630999 TACTGCCCAAAGTAATTTACAGG + Intronic
1034403442 7:150883564-150883586 TATTGCCCAAAGCAATCTACAGG + Intergenic
1035508432 8:154928-154950 TACTGCCCAAAGCGATTTATAGG + Intergenic
1036539956 8:9696870-9696892 TACTGCCCAAAGCAGTTTACAGG + Intronic
1037154248 8:15680156-15680178 TTCTGCCCAAAGCAATCTACGGG - Intronic
1041114314 8:54519845-54519867 TATTTCCCAAAACAATTCACTGG - Intergenic
1043105928 8:76109902-76109924 TACTGCCCAAGGTAATTTATAGG + Intergenic
1043706980 8:83362114-83362136 TACTACCTAAAGCAATCTACAGG + Intergenic
1043923484 8:86010458-86010480 TACTGCCCAAAGCAATTTATAGG - Intronic
1044381477 8:91539317-91539339 TACCACCCAAAGCAATCTACAGG - Intergenic
1044760532 8:95513195-95513217 CACTGCCAAAAGCAATTAAAAGG - Intergenic
1045124416 8:99073301-99073323 TACTGCCCAAAGCAATCTACAGG - Intronic
1045611923 8:103853959-103853981 TACTGGCCAAGGCAATTTACAGG - Intronic
1045715429 8:105038081-105038103 TGCTGCCCAAAGTAATTTATAGG + Intronic
1045882818 8:107061255-107061277 TAATGCCCAAAGTAATTTATAGG - Intergenic
1045946041 8:107797420-107797442 TACTGCACAAAGTAATTTATAGG + Intergenic
1046188772 8:110761811-110761833 TGCTGCCCAAAGCAATTTATAGG + Intergenic
1046236808 8:111434830-111434852 TACCGCCCAAAGTAATTTACAGG - Intergenic
1046708634 8:117484526-117484548 TATTGCCCAAAGCAATATACAGG - Intergenic
1047268559 8:123331800-123331822 TACTGCAATAAGCAATTTACTGG + Intronic
1048445948 8:134493433-134493455 TACTGGCCAAACCAACTCACTGG + Intronic
1048640850 8:136359123-136359145 TACTGCCCAAAGAAATTTACAGG - Intergenic
1048714197 8:137249416-137249438 TACTGCCCAAAGCGATGTACAGG + Intergenic
1048824140 8:138407326-138407348 TACTGCCCAAGGTAATTTATAGG + Intronic
1049233913 8:141499159-141499181 TATTGCCCAAAGCCAATGATAGG + Intergenic
1049485246 8:142854498-142854520 TACTGCCCAAGGTAATTTATAGG + Intronic
1049952869 9:662245-662267 TACTGCCCAAGGTAATTTATAGG + Intronic
1050520826 9:6498237-6498259 TATAACCCACAGCAATTGACTGG + Intronic
1050643891 9:7697978-7698000 CACTGCCCAAAGCAATCTACAGG - Intergenic
1050891173 9:10826356-10826378 TACTTCCCCAAGCAATTTACAGG - Intergenic
1051129585 9:13844861-13844883 TACTACCCAAAGCAATGTACAGG + Intergenic
1051884561 9:21876931-21876953 CACTACCCAAAGCAATTTATAGG - Intronic
1055125291 9:72712341-72712363 TACTGCCCAAAGTAATTTGTAGG - Intronic
1055523242 9:77103780-77103802 TACTGCCCAAAGCAATTTAGAGG + Intergenic
1055683866 9:78748491-78748513 TACTGCCAAAAACAATCTACAGG - Intergenic
1055843101 9:80530045-80530067 TACTGCCCAAAATAATTAATAGG + Intergenic
1055987390 9:82065011-82065033 TACTTTCCAAAGCAATTTGCAGG + Intergenic
1056174209 9:84018338-84018360 TACTACCCAAAGTAATTTACAGG - Intergenic
1056730836 9:89165472-89165494 TATTTCCCAAAGCAATTTTCTGG + Intronic
1057389281 9:94629476-94629498 TACCACCCAAATCAATTAACAGG - Intronic
1057451333 9:95163521-95163543 TACTACCCAAAGCAATCTTCAGG - Intronic
1057643237 9:96848746-96848768 TTCTGCCCAAAGCAATCTACAGG + Intronic
1058490215 9:105491078-105491100 TACTGCCCAAGGTAATTTACAGG - Intronic
1058532286 9:105918063-105918085 TACTGGCCAAAGCAAGTCACAGG + Intergenic
1059796852 9:117706900-117706922 TAATGCCCACAGCACTTGGCAGG + Intronic
1059902002 9:118938231-118938253 TACTGCCCAAAGCAATTTATAGG - Intergenic
1059995137 9:119901692-119901714 TACTGCCCAAAGCAATTGATAGG - Intergenic
1062387855 9:136321355-136321377 TACTGCCCAAAGCAATGTATAGG - Intergenic
1062759546 9:138331971-138331993 TACTGCCCAAAGCGATTTATAGG - Intergenic
1203599993 Un_KI270748v1:2743-2765 TACTGCCCAAAGCGATTTATAGG - Intergenic
1187551648 X:20312030-20312052 TATTGCCCAAAACAAGTTACAGG - Intergenic
1187799426 X:23044083-23044105 TAATGCCGAAAGCAAGTGACTGG + Intergenic
1188121675 X:26315991-26316013 TACTGCCCAAGGTAATTTACAGG - Intergenic
1189408956 X:40752645-40752667 TACTACCCAAAGCAATCTATGGG - Intergenic
1189872203 X:45395760-45395782 TATTGCCCAAAGCAATTTACAGG - Intergenic
1190400887 X:50033587-50033609 TACTGCCCAAGGTAATTTATAGG + Intronic
1190604987 X:52131968-52131990 TATTGCCCCAAGCAATTTGCAGG + Intergenic
1190959513 X:55232029-55232051 TAATTCCCAAAGCAATTTGCAGG + Intronic
1190974193 X:55383969-55383991 TACTGGCTAAAGCAATTTACAGG + Intergenic
1191048489 X:56165246-56165268 TACTGCCCAAAGCAATGTATAGG - Intergenic
1191656728 X:63606649-63606671 TTCTGCCCAAATCAATCTACAGG + Intergenic
1191757937 X:64614614-64614636 TGCTACCCAAAGCAATTTACAGG - Intergenic
1191760179 X:64638546-64638568 TACTGCCCAAAGCAATCTACGGG - Intergenic
1191845850 X:65547447-65547469 TGCTGCTGAAAGCAATTCACTGG - Intergenic
1191987070 X:66993512-66993534 TACTGCCCAAAGTAATTTACAGG - Intergenic
1192827789 X:74716516-74716538 TACTGCCCAAGGTAATTTATAGG + Intergenic
1193072109 X:77317069-77317091 TATTGCCCAAAGTAATTTATAGG + Intergenic
1193190873 X:78569430-78569452 TATTGCCCAAAGCAATCTATAGG - Intergenic
1193550237 X:82883647-82883669 TATTGCCCAAAGCATTTTACAGG + Intergenic
1193592897 X:83411610-83411632 TACTGCCCAAGGTAATTTACAGG + Intergenic
1193687087 X:84591108-84591130 TACTGTCCAAAGCAATTTGCAGG + Intergenic
1193695388 X:84701626-84701648 TACTGCCCAAGGTAATTTATAGG + Intergenic
1193735492 X:85151385-85151407 TACTGCCCAAGGTAATTTATAGG + Intergenic
1193736960 X:85168691-85168713 TACTTCCCAAAACAATTTATAGG + Intergenic
1193776919 X:85654195-85654217 TACTACCCAAAGCAATCTATAGG - Intergenic
1193784552 X:85743904-85743926 TACTTTCCAAAGCAATATACAGG + Intergenic
1193947737 X:87759141-87759163 TACTATCCAAAGCAATTTATGGG - Intergenic
1193999097 X:88404942-88404964 TACTGTCCAAAGCAATTTAGAGG - Intergenic
1194125795 X:90014280-90014302 TACTACCCAAAGCAATATATAGG - Intergenic
1194251505 X:91581128-91581150 TACTGCCCAAAGCAATGTACGGG - Intergenic
1194273838 X:91855570-91855592 TACTACCTAAAGCAATCTACAGG - Intronic
1194346998 X:92777956-92777978 TACAGCCCAAAGCAATTTATAGG + Intergenic
1194433481 X:93840050-93840072 CACTGCCCAAAGCAATCTGCAGG - Intergenic
1194962752 X:100254608-100254630 TACTGCCCAAAGCAATTTATAGG + Intergenic
1195142298 X:101974132-101974154 TACTGCCCAAAGCAATTTAGAGG - Intergenic
1195171822 X:102276253-102276275 TAATACCCAAAGCAATCTACAGG - Intergenic
1195179977 X:102348776-102348798 TACTGCCCTAAGCAATTTGCAGG - Intergenic
1195187038 X:102410840-102410862 TAATACCCAAAGCAATCTACAGG + Intronic
1195344531 X:103936223-103936245 TACTGCCCAAAGTAGTTTATAGG - Intronic
1195855453 X:109327227-109327249 TACTTCCCAAAGCAATTTATAGG - Intergenic
1196390423 X:115202071-115202093 TACTGCCCAAAGCAATCTACAGG + Intronic
1196475187 X:116076212-116076234 TGCTGTCCAAAGCAATTTATGGG + Intergenic
1196493956 X:116301921-116301943 TACAACCCAAAGCAATCTACAGG - Intergenic
1196524615 X:116717737-116717759 TACTGCACAAAGCAATTTACAGG + Intergenic
1196997323 X:121398448-121398470 TACTTCCCAATACAATTAACCGG - Intergenic
1197013944 X:121601373-121601395 TACTGCCCAAAATAATCAACAGG - Intergenic
1197141868 X:123126300-123126322 TACTGCCCAAAGCAATTTATAGG + Intergenic
1197487193 X:127067513-127067535 TACTACTCAAAGCAATCTACAGG - Intergenic
1197508706 X:127343498-127343520 CACTACCCAAGGCAATTTACAGG + Intergenic
1197548604 X:127859881-127859903 TACAGCCCAAGGCAATTCACAGG - Intergenic
1197565289 X:128076724-128076746 TACTCCCTAAAGCAATCTACAGG + Intergenic
1198277326 X:135107827-135107849 TACTGCCCAAAGCAATTTACAGG - Intergenic
1199043669 X:143143755-143143777 TACTACCCAAAGCAATCTGCAGG + Intergenic
1199182071 X:144869442-144869464 TACTTCCCAAAACAATTTACAGG - Intergenic
1199242141 X:145559762-145559784 TACTGCCCAAAGCAGTCTTCAGG + Intergenic
1199292196 X:146117560-146117582 TACTGCCCAAAGCAATTTATAGG + Intergenic
1200309832 X:155066889-155066911 TACCTCCCAAAGCATTTGAGTGG + Intronic
1200570443 Y:4822359-4822381 TACTGCCCAAAGCAATGTACGGG - Intergenic
1200591076 Y:5076987-5077009 TACTACCTAAAGCAATCTACAGG - Intronic
1201356313 Y:13100584-13100606 TACTGCCTGAAGCAATTTATAGG + Intergenic
1201708249 Y:16960382-16960404 TACTGCCCAAAGTAATTTATAGG + Intergenic
1201970065 Y:19782359-19782381 TACTGCCCAAGGTAATTTATAGG + Intergenic
1202018623 Y:20439425-20439447 CACTGCCCAAAGCAGTTTATAGG + Intergenic
1202033319 Y:20602990-20603012 CACTGCCGAAATCAATTTACAGG - Intergenic
1202043351 Y:20711001-20711023 TACTGCCCAAAGTAATTTATAGG + Intergenic
1202586398 Y:26432737-26432759 TACTGCCCAAAGTAATTTGTAGG + Intergenic