ID: 1105884322

View in Genome Browser
Species Human (GRCh38)
Location 13:24628971-24628993
Sequence CCTTCCAAGTTCACACTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105884322_1105884335 20 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884335 13:24629014-24629036 CCATGGGGATTGCCAAGACTGGG 0: 1
1: 0
2: 0
3: 15
4: 127
1105884322_1105884329 5 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884329 13:24628999-24629021 GGGTCCCCACTGCTGCCATGGGG 0: 1
1: 0
2: 2
3: 24
4: 209
1105884322_1105884337 28 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884337 13:24629022-24629044 ATTGCCAAGACTGGGTGGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 148
1105884322_1105884327 3 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884327 13:24628997-24629019 CAGGGTCCCCACTGCTGCCATGG 0: 1
1: 3
2: 5
3: 45
4: 388
1105884322_1105884338 29 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884338 13:24629023-24629045 TTGCCAAGACTGGGTGGTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 175
1105884322_1105884328 4 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884328 13:24628998-24629020 AGGGTCCCCACTGCTGCCATGGG 0: 1
1: 0
2: 1
3: 17
4: 153
1105884322_1105884336 23 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884336 13:24629017-24629039 TGGGGATTGCCAAGACTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 164
1105884322_1105884333 19 Left 1105884322 13:24628971-24628993 CCATAAAGTGTGAACTTGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1105884333 13:24629013-24629035 GCCATGGGGATTGCCAAGACTGG 0: 1
1: 0
2: 1
3: 16
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105884322 Original CRISPR CCTTCCAAGTTCACACTTTA TGG (reversed) Intergenic
901635748 1:10669375-10669397 CCATCGCAGTTAACACTTTAAGG - Intronic
901793350 1:11666139-11666161 CCTGCCGAGGTCACACTCTAGGG - Intronic
902938235 1:19780249-19780271 TCTTCCAGGTCCACACTGTATGG - Intronic
908905904 1:69008362-69008384 ACTACCAAGTTCTCACTTTATGG + Intergenic
910936989 1:92492242-92492264 CCTGCCAAGTCCACACTGTTGGG - Intergenic
911080970 1:93930294-93930316 CATTCTAAGGTCACACTTCAAGG + Intergenic
911743511 1:101413621-101413643 CAATCTAAGGTCACACTTTAAGG + Intergenic
912351333 1:109016530-109016552 CCTTGCATCTTCACAGTTTAGGG - Intronic
912827057 1:112915263-112915285 CCAGCTAAGTTGACACTTTAAGG - Intronic
914455180 1:147829883-147829905 CATTCTAAAGTCACACTTTAAGG - Intergenic
920198711 1:204246033-204246055 CCATCTAAGTGAACACTTTATGG + Intronic
920826465 1:209427971-209427993 CCTTCCAAGTGCACACCTGGAGG - Intergenic
922395758 1:225199411-225199433 CTTTCTAAGGTCACACTTCAAGG - Intronic
923438867 1:233996459-233996481 CCTTCCAAATTCACACCTGGTGG - Intronic
924321152 1:242852223-242852245 CAATCTAAGGTCACACTTTAAGG - Intergenic
1063601635 10:7486587-7486609 CCTCCCAACTTCCCACTTTTTGG + Intergenic
1065194618 10:23251188-23251210 GCTTCTAAGTTCACCATTTACGG - Intergenic
1068720571 10:60241119-60241141 CCTTCAAAGTTTACATATTAGGG - Intronic
1069700908 10:70425101-70425123 ACTTCCAAGTTCTCTCTTTGTGG + Exonic
1074519951 10:114210648-114210670 CATTCAAAGTTAACACTTTTGGG - Exonic
1078780679 11:14436212-14436234 CCTGCCAATTTCACTCCTTAGGG + Intergenic
1080589684 11:33711000-33711022 CCTTCCATGTTAGCACTTGAAGG - Intronic
1081058178 11:38437341-38437363 AGTTCTAAGATCACACTTTAAGG - Intergenic
1082722404 11:56694486-56694508 CCTCCAAAATTCACATTTTAAGG - Intergenic
1085654809 11:78304237-78304259 CCTTTCAAGTATACAATTTAGGG + Intronic
1086201758 11:84211959-84211981 CCTTTCCAGCTCACACTTGAGGG - Intronic
1086559128 11:88146897-88146919 TCTTCAAAGTTCACACTTAGAGG + Intronic
1087496875 11:98902603-98902625 TCTTCTAAGTTAACACTTAAGGG + Intergenic
1090320386 11:125838123-125838145 ATTTCCAACTTCACACTGTAGGG + Intronic
1090524586 11:127518818-127518840 CCTTCCTATTTTACATTTTATGG + Intergenic
1091215310 11:133897782-133897804 CCATTCAAGTTCACACTCAAAGG + Intergenic
1095741070 12:45607866-45607888 CCATTCAAGTTCACACCTTATGG + Intergenic
1097408393 12:59220562-59220584 CCTGTCAGGTTCACACTTCAAGG + Intergenic
1097817633 12:64092276-64092298 CCTTTGTAGTTCACATTTTATGG + Intronic
1100754923 12:97740817-97740839 CCATCCATCTTCTCACTTTAAGG - Intergenic
1101565066 12:105897260-105897282 CCTTCAAAGCTCACAGGTTAGGG + Intergenic
1102829280 12:115981197-115981219 ACTACCATGTTCCCACTTTAGGG + Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1107755727 13:43620321-43620343 CATTCTAAGGTCATACTTTAAGG - Intronic
1111988680 13:95092643-95092665 CATTCCAAGGTCACACCTCAAGG + Intronic
1113170996 13:107503163-107503185 CCTGCCCAGTTCATTCTTTAAGG + Intronic
1113391559 13:109902536-109902558 ACTTCTAAGTGCACACCTTAGGG + Intergenic
1116048787 14:39778550-39778572 CATTCCAAGGTCACACCTCAAGG - Intergenic
1117520798 14:56549662-56549684 CCTTCCAGGTTCCCAGTTCATGG + Intronic
1117947575 14:61045404-61045426 CCTTTGAAGTTCACAGTATATGG - Exonic
1119859682 14:77927070-77927092 CCACCCAAGGTCACACTGTAAGG - Intronic
1122913623 14:104845652-104845674 CCTCCCAAGTTCACATGTGATGG + Intergenic
1124455308 15:29836876-29836898 GCTTCCAAGTTGGCACTTTGTGG - Intronic
1125094437 15:35834750-35834772 CCTTGCACATTAACACTTTAGGG + Intergenic
1126667608 15:51089378-51089400 CCTTCCTATTGCATACTTTATGG - Intronic
1127574534 15:60278286-60278308 CCTTCCATGTTCACAGTCAATGG + Intergenic
1127780278 15:62306873-62306895 TCTTCCAAGTTCCCATTTTGAGG - Intergenic
1128921872 15:71618304-71618326 ACTTCCAGGTATACACTTTAGGG + Intronic
1133076520 16:3284687-3284709 CTTTCAAAGTTCACAATTAACGG - Intronic
1141373178 16:83505995-83506017 CTTTCCAAGTTCACACATTCAGG + Intronic
1141896760 16:86963306-86963328 CTTTCCAAGCTCACCCTTTCTGG - Intergenic
1142939453 17:3370594-3370616 CAATCTAAGTTCACACCTTAAGG - Intergenic
1144430239 17:15184485-15184507 CATTCCAATTCCACTCTTTAAGG - Intergenic
1146242034 17:31238754-31238776 TCTTTGAAGGTCACACTTTAAGG + Intronic
1146376020 17:32295177-32295199 CCTTCCCAGTTCCCACTCCAGGG - Intronic
1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG + Intronic
1149385019 17:56134297-56134319 CTCTCCAAGTCCACAGTTTAGGG + Intronic
1156054514 18:32982944-32982966 CACTCCAAGTTCATACTTTAGGG - Intronic
1157541106 18:48508056-48508078 CATTCTAAGGTCACACTTCAAGG + Intergenic
1163185074 19:15632029-15632051 CCTTCCAGGTTCCCAATCTATGG - Intronic
1163910442 19:20186154-20186176 GCTTCCCAGATCACATTTTAAGG - Intronic
1163932362 19:20408856-20408878 GCTTCCCAGGTCACATTTTAAGG + Intergenic
1163947440 19:20552381-20552403 GCTTCCCAAATCACACTTTAAGG + Intronic
925524316 2:4782931-4782953 CCTTCCATGTTCATTCTTCAAGG - Intergenic
928168805 2:28990317-28990339 CCTTCCAAGGCCCCACTTGAGGG + Intronic
929150627 2:38745109-38745131 GCTCTCAAGTTCACCCTTTAGGG - Exonic
930971931 2:57406823-57406845 CCTACCAAATCCAGACTTTATGG - Intergenic
932624942 2:73290063-73290085 CCTTCCAAGTGAACTCTTCATGG - Intergenic
935688951 2:105713160-105713182 CCTTCCAATTTCATCATTTACGG - Intergenic
935954220 2:108359496-108359518 CCTTCTAAGGTCACACCTCAAGG + Intergenic
936476715 2:112845961-112845983 CCTTCCAAGTCCTCACTTGCTGG + Intergenic
936794619 2:116190103-116190125 ACTTCCAAATTCACTCTTTAAGG - Intergenic
937203517 2:120221700-120221722 CTTTCCAGGTTCGCACTTTCAGG - Exonic
937521995 2:122722964-122722986 CATTCCAAGGTCACACCTCAAGG + Intergenic
937592109 2:123627244-123627266 CCTTGTAAGTCCACAGTTTAGGG + Intergenic
938563894 2:132499455-132499477 CCCCCCAACTTCACACTATAAGG - Intronic
940709140 2:157141393-157141415 CCTTCTAAGGTCACACCTCAGGG - Intergenic
940747605 2:157586369-157586391 CCTTACAAATTAACATTTTAAGG - Intronic
942207225 2:173631230-173631252 CTTTCCAACTTCAGGCTTTATGG - Intergenic
942634393 2:177986948-177986970 TCTTCAAAGTTAACATTTTATGG - Intronic
943171168 2:184402396-184402418 CCTTCCATATTCTCATTTTATGG - Intergenic
943531268 2:189084023-189084045 TCTGCCAGGTTCACCCTTTATGG + Exonic
944302987 2:198145882-198145904 CCTTTCAAGGTCACACTTTCAGG + Intronic
946547179 2:220756948-220756970 CCTTCCAAGTTCAAAACTTCTGG + Intergenic
1169609186 20:7360253-7360275 CCTTTCAATTTCACAGTCTAGGG + Intergenic
1172239110 20:33400383-33400405 ATTTTAAAGTTCACACTTTAAGG - Intronic
1172372857 20:34408784-34408806 ACTTCCAAGCTTACACTGTAAGG - Exonic
1173085808 20:39915837-39915859 TCTTCCATGTTCCCACTGTATGG + Intergenic
1173617139 20:44410644-44410666 CCTTTCCAGCTCACACTTTCTGG - Intronic
1175804200 20:61818378-61818400 CCAGCCAAGTTCCCACTTTTTGG - Intronic
1177222388 21:18210912-18210934 CCTTCAAAGTTTACACTGTTTGG + Intronic
1178488741 21:33034604-33034626 GCTTCCAAGATCACCCATTATGG - Intergenic
1182635884 22:31726684-31726706 TCTTTCAAGTTAACACTTCATGG + Intronic
1183232962 22:36594254-36594276 CCTTCCAGGCTCACATTCTAGGG + Intronic
951162912 3:19448266-19448288 CCTACCAAGTTCACACAATTAGG + Intronic
951320155 3:21234817-21234839 CTTTCTATGTTCACATTTTATGG - Intergenic
951572177 3:24076181-24076203 CATTCTAAGGTCACACTTCAAGG - Intergenic
952565360 3:34650838-34650860 TCTTTCAAGTTCCCCCTTTAGGG + Intergenic
955596640 3:60597657-60597679 CCTCCCATGTTCACACTTGAGGG - Intronic
955903536 3:63783063-63783085 CCACCCAAGATCATACTTTATGG - Intergenic
957243896 3:77694081-77694103 CCTTCCATCTTCATACTTTCAGG - Intergenic
960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG + Intronic
961444151 3:126971186-126971208 CCTCTCAACTTCACACTATAAGG - Intergenic
961589130 3:127962264-127962286 CCTCCCAAGTCCACACTGGAAGG - Intronic
961700047 3:128736814-128736836 CCTTCCAAGTCCACACATGTAGG - Intronic
961941356 3:130640303-130640325 CTTTCCAGATTCACATTTTATGG + Intronic
962424598 3:135258660-135258682 CACTCCAAGTGCACACTATACGG - Intronic
962839135 3:139217810-139217832 CCTCCCAAGCCCACACTTGAGGG - Intronic
963176344 3:142301608-142301630 CCATCTAAGGTCACACTTCAAGG + Intergenic
963869835 3:150403616-150403638 CCTTCAAAGATCCCACATTAAGG + Intergenic
964977950 3:162641433-162641455 CTTTTCACTTTCACACTTTAAGG - Intergenic
967764428 3:193262546-193262568 CCTTCCAAATTAATACTGTAGGG - Intronic
968434697 4:578444-578466 CCTTCCACCCTCACCCTTTAGGG - Intergenic
969122110 4:4918371-4918393 CCTTCTAAGTTTACAATCTAGGG + Intergenic
971744556 4:30562746-30562768 CCTTCAAAGTTTCCGCTTTATGG + Intergenic
974020079 4:56685374-56685396 GCTTGCAAGTTCACACCTTGGGG - Intergenic
974088710 4:57288286-57288308 TCTTCCCAGTTCACTCTTCAGGG - Intergenic
975333123 4:73142385-73142407 CCTTCCATATTCACTCTTTTAGG - Exonic
975569317 4:75796997-75797019 CTTTCCATGTTCAGATTTTAAGG + Intronic
977019682 4:91743965-91743987 CATTCTAAGGTCACACCTTAAGG - Intergenic
977190693 4:93997276-93997298 CCTTCCAAGTTCTTGCTTGAAGG + Intergenic
980152957 4:129070848-129070870 CATTCCAAGGTCACACCTCAAGG - Intronic
982967007 4:161922624-161922646 GCTTCCAGGATCAAACTTTAGGG + Intronic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
984504833 4:180603986-180604008 ACTTCAAAGGTCACAGTTTATGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
993418700 5:87671896-87671918 CCTTCCAAGTTCCTTCTTTCTGG + Intergenic
995818083 5:116194237-116194259 CATTCCAAGGTCACACTTCAAGG + Intronic
995843797 5:116471225-116471247 GCTTCCGTGTTAACACTTTAAGG - Intronic
997385345 5:133468003-133468025 CATTCCAGGTTCATAATTTATGG + Intronic
998097854 5:139407098-139407120 CCATCCCAGTTCACACTGCATGG - Intergenic
1000193712 5:158938001-158938023 CCTGGCATGTTCACACTATAAGG + Intronic
1002378383 5:178805615-178805637 TCTTCCAAGTTCCCACTCTGTGG + Intergenic
1003856784 6:10284394-10284416 CCTAACAAATTAACACTTTAAGG - Intergenic
1008065760 6:47046217-47046239 CATTCCAATTATACACTTTAAGG + Intergenic
1008358347 6:50583991-50584013 CCTTCCATGATAACACTGTAAGG - Intergenic
1009969094 6:70607560-70607582 CATTCTAAGGTCACACTTCAAGG + Intergenic
1010962969 6:82167986-82168008 CCTTCCCAATTCACTCTATAAGG + Intergenic
1011861059 6:91757141-91757163 TCTTCCAAGTTCACCATTAAAGG + Intergenic
1012089787 6:94876387-94876409 CCTTCCCAGTTCACTCTTAGAGG + Intergenic
1015362119 6:132352206-132352228 CATTCTAAGGTCACACTTCAAGG - Intronic
1017608196 6:156155692-156155714 CCTTCAGAGTTCACACCTGAAGG - Intergenic
1017828419 6:158100942-158100964 CCTCCCAAGTCCATAGTTTAGGG + Intergenic
1018361279 6:163072068-163072090 ACTTCCAAGTTCATTCTATAAGG + Intronic
1018785771 6:167106750-167106772 CCCTCCAACTTCACACTTACTGG + Intergenic
1022541137 7:31136298-31136320 ACTTCCAAGCTGAAACTTTAAGG + Intergenic
1023953537 7:44867244-44867266 CCTTCAAAGGTCACACTTTAAGG - Intergenic
1024745102 7:52397319-52397341 CATTCTAAGGTCACACTTTAAGG - Intergenic
1025020008 7:55473270-55473292 CGTTACCAGTTCACACATTAGGG + Intronic
1028824588 7:95256052-95256074 CCCTCCTTGTTCACACTTTTGGG - Intronic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1031565536 7:123292591-123292613 ACTTCCAAGTTCTCAGTTCATGG - Intergenic
1031772572 7:125863159-125863181 TCTTCCTAGTTCAGACTTGAGGG + Intergenic
1032932563 7:136690407-136690429 CCGGCCAAGTTGACTCTTTAAGG - Intergenic
1033926106 7:146462426-146462448 CCTTCTAACTTCACACATAAAGG + Intronic
1036287230 8:7453850-7453872 CCTTTGAAGTTAAGACTTTAGGG + Intronic
1036334250 8:7857674-7857696 CCTTCGAAGTTAAGACTTTAGGG - Intronic
1039083037 8:33752733-33752755 CTTTCTAAGGTCACACCTTAAGG - Intergenic
1039188642 8:34946630-34946652 CCTTCCAAGCTCAGCCATTAAGG + Intergenic
1041563016 8:59241929-59241951 CATTCCTAGCTCACACTTTCAGG - Intergenic
1043121417 8:76330084-76330106 CATTCTAAGTTCACACCTCAAGG - Intergenic
1046235810 8:111423095-111423117 CATTCTAAGGTCACACCTTAAGG + Intergenic
1046500386 8:115069233-115069255 CCTTTCAACTTGACACATTATGG + Intergenic
1047177441 8:122554962-122554984 CTCTCCAAGTTCACACTGCAAGG - Intergenic
1047727723 8:127698627-127698649 CCTTCTAAGTTCCCATTCTAAGG + Intergenic
1049176086 8:141193532-141193554 CCTTCCAATTTCTCCCTTTTCGG - Intronic
1049295723 8:141835441-141835463 CCTTCCAAGGTCACACCTCAAGG - Intergenic
1051059873 9:13033322-13033344 CCTCCCAAATTCCCACTTCATGG + Intergenic
1055211018 9:73791386-73791408 CCTTCCAAATTCCAACTCTATGG - Intergenic
1058005702 9:99911657-99911679 TCTTGCAGGCTCACACTTTAGGG + Intronic
1061049394 9:128185602-128185624 CCTTCCCAGTTCAACCTTTCAGG - Exonic
1186550759 X:10502763-10502785 CATTCCAAGGTCACAAATTAAGG + Intronic
1188629395 X:32333738-32333760 CCTTGAAAATTCAGACTTTAAGG + Intronic
1190895211 X:54611423-54611445 CATTCTAAGTTCACACCTCAAGG - Intergenic
1192820494 X:74639731-74639753 CATTCTAAGCTCACACTTCAAGG + Intergenic
1194468414 X:94260800-94260822 CAATCTAAGATCACACTTTAAGG + Intergenic
1195795767 X:108645139-108645161 CATTCCAAGGTCACACCTCAAGG + Intronic
1196949894 X:120866905-120866927 TCTTCCTAGTTCCCACATTAGGG + Intergenic