ID: 1105887382

View in Genome Browser
Species Human (GRCh38)
Location 13:24653461-24653483
Sequence GGTCTCCTGCAGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 199}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105887382_1105887390 20 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887390 13:24653504-24653526 AATCAAGGAGGAAAACCAGGAGG 0: 1
1: 0
2: 3
3: 51
4: 612
1105887382_1105887387 5 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887387 13:24653489-24653511 AAAAGAAACAGCAGGAATCAAGG 0: 1
1: 0
2: 5
3: 86
4: 935
1105887382_1105887388 8 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887388 13:24653492-24653514 AGAAACAGCAGGAATCAAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 442
1105887382_1105887389 17 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887389 13:24653501-24653523 AGGAATCAAGGAGGAAAACCAGG 0: 1
1: 0
2: 5
3: 35
4: 527
1105887382_1105887391 21 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887391 13:24653505-24653527 ATCAAGGAGGAAAACCAGGAGGG 0: 1
1: 0
2: 2
3: 49
4: 492
1105887382_1105887392 29 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887392 13:24653513-24653535 GGAAAACCAGGAGGGAAACAAGG 0: 1
1: 0
2: 7
3: 71
4: 697
1105887382_1105887384 -3 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887384 13:24653481-24653503 ACCCTATCAAAAGAAACAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 157
1105887382_1105887393 30 Left 1105887382 13:24653461-24653483 CCTTCCACATTCTGCAGGAGACC 0: 1
1: 0
2: 2
3: 26
4: 199
Right 1105887393 13:24653514-24653536 GAAAACCAGGAGGGAAACAAGGG 0: 1
1: 0
2: 6
3: 63
4: 582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105887382 Original CRISPR GGTCTCCTGCAGAATGTGGA AGG (reversed) Intergenic
900630037 1:3629993-3630015 GGCCACCTGCAGGATGTGCAGGG + Exonic
900631277 1:3636945-3636967 GTTGTCCTGCTGACTGTGGAGGG - Intronic
900749696 1:4387591-4387613 GTTCTCATGCTGAATGAGGATGG + Intergenic
902478058 1:16698433-16698455 GCCCTGCTGCAGACTGTGGAGGG + Intergenic
903403316 1:23074658-23074680 GTTCTCCTGCAGAAATTGTATGG + Intronic
903778646 1:25808508-25808530 GGTCTCCTGTACCATGTGGGTGG - Intronic
904400329 1:30252539-30252561 GGTCGCCTGGAGAAGGAGGAGGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906087140 1:43145486-43145508 TGTCTCCTGCAAAAAGGGGAGGG + Intronic
908413158 1:63886632-63886654 CTTCTCCTTCAGAATGTTGAAGG + Intronic
911587329 1:99705589-99705611 GGACTGGTGCAGGATGTGGAAGG + Intergenic
914926528 1:151893564-151893586 GGTCTCCCTAAGAGTGTGGATGG + Intronic
915287217 1:154860703-154860725 GGACACCTGCAGACAGTGGAGGG + Intronic
917726682 1:177834462-177834484 GGTCTATTGCAGAATTTGAATGG + Intergenic
917791651 1:178502987-178503009 GGTCATCTGCATAGTGTGGATGG - Intergenic
920245829 1:204586696-204586718 GGTGTCCTTCAGGAGGTGGAAGG - Intergenic
920357724 1:205387183-205387205 GTTCTCCTGCAGTATGTAGAAGG + Intronic
920968311 1:210720505-210720527 AGTCTCAGGAAGAATGTGGAAGG + Intronic
922184800 1:223264806-223264828 GGTCTCAGGCAGCCTGTGGAAGG + Exonic
922810182 1:228410940-228410962 GCTCACCTGCAGCATCTGGAGGG + Exonic
923558728 1:235022172-235022194 TGTCTCCTGCAGAATGAGCACGG + Intergenic
1065952725 10:30666647-30666669 GATATCGTGCAAAATGTGGAAGG - Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067066388 10:43106359-43106381 GGTGTCCTGCAGGATGCAGAGGG - Exonic
1067426851 10:46217177-46217199 GGGCCACTGCAGGATGTGGAGGG + Intergenic
1069758856 10:70793754-70793776 AATCTACTGCAGTATGTGGATGG - Intergenic
1071561619 10:86650255-86650277 GGGCTCCTGCAGAAGATGGGAGG + Intergenic
1071887718 10:89969094-89969116 GGGCAGCTCCAGAATGTGGATGG + Intergenic
1072588840 10:96808111-96808133 GGTCTCCTCCAGCCTGTGGCAGG - Intergenic
1073242789 10:102069130-102069152 GGCCTCCTCCAGAACTTGGATGG + Intergenic
1075783631 10:125033288-125033310 AGGCTCCTGCTGGATGTGGAAGG + Intronic
1075981796 10:126746708-126746730 GGTCTACAGCAGAAGATGGATGG + Intergenic
1076787793 10:132759706-132759728 GGGCTCCTGCAGGGTGAGGAGGG - Intronic
1077759138 11:5071941-5071963 AGTCTCCTGCAGCTTGGGGAGGG - Intergenic
1077997549 11:7466977-7466999 GGCCACCTGCAGAAGGTGGCTGG - Exonic
1080540824 11:33263200-33263222 AGTCTCCTACAGAATGGGAAAGG - Intronic
1080786315 11:35478253-35478275 GGTCTCTTGCAGTCTCTGGAGGG + Intronic
1083152689 11:60802768-60802790 GTTGTCTTGCAGAATGTTGATGG + Intergenic
1083313050 11:61795512-61795534 GATGTGCTGCAGAATGAGGAGGG + Exonic
1085330221 11:75642679-75642701 GGTCACCTTCTGAAAGTGGAAGG - Intronic
1087390627 11:97527706-97527728 GGTCTCCTTCAGTAGGTGAATGG - Intergenic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1089665802 11:120018035-120018057 GGTACCCTGCAAAACGTGGATGG - Intergenic
1091131842 11:133153130-133153152 GAGCTGCTGCAGAATGTGGGAGG - Intronic
1091565744 12:1646696-1646718 GGTCTTGTCCAGAATGTAGATGG + Exonic
1091821432 12:3478420-3478442 GGCTTCCTTCAGAAGGTGGAGGG - Intronic
1093158880 12:15721228-15721250 GGTTTCCTACAGATTGTGAATGG - Intronic
1093286536 12:17270469-17270491 AGTTTCCTTCAGAATGTTGAGGG + Intergenic
1093535052 12:20212833-20212855 CGCCTCCTGCCAAATGTGGAGGG - Intergenic
1096107907 12:49008726-49008748 GTTTTCCTGCAGAATGTTGAAGG + Intronic
1097925894 12:65126002-65126024 GGTCTCCTCCAGGATATGCATGG - Intergenic
1098180113 12:67838218-67838240 GGTCTAATGCTGAAGGTGGAGGG + Intergenic
1099426977 12:82535415-82535437 GTGGTCCTGCAGAATGAGGATGG - Intergenic
1100025328 12:90121586-90121608 GTTCTCCTGCATAATGTGTATGG + Intergenic
1101044515 12:100790933-100790955 GGTCTCCTGCTGAATGCTGAAGG + Intronic
1101958983 12:109233954-109233976 GGACACATTCAGAATGTGGATGG - Exonic
1102633099 12:114299379-114299401 TGCCTCCTGCAGGATGAGGATGG + Intergenic
1103342438 12:120228299-120228321 GGTTTCCTCCAGAAAGTGGTTGG - Intronic
1105503517 13:20991524-20991546 GGTCTCCTGCAGCATATCGCAGG - Intronic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1108744264 13:53374925-53374947 AGTCTCCTGAAGAATCTGCAGGG + Intergenic
1109386502 13:61634908-61634930 GCTCTCCTGAAGTATGTTGATGG - Intergenic
1111443586 13:88314284-88314306 GATATCCTTCAAAATGTGGATGG - Intergenic
1114564842 14:23623097-23623119 AGGCTACTGGAGAATGTGGAAGG - Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1116743963 14:48793342-48793364 GGTCTCCTGGAGTTTGTGGGAGG - Intergenic
1121119923 14:91370243-91370265 AGTCTCCTTCAGAAGGGGGAAGG + Intronic
1122906924 14:104805876-104805898 GGTTTCCTGGAGTTTGTGGAAGG - Intergenic
1123172822 14:106390465-106390487 GGTGACCTGCAGGATGTGTAAGG - Intergenic
1124038547 15:26079294-26079316 GGTCCTCTGGAGAATGGGGAAGG - Intergenic
1126915369 15:53460356-53460378 GGTCTCCCACAGAATTTGGATGG - Intergenic
1127065567 15:55234264-55234286 GATGTTCTGCAGAATGTTGAAGG - Intronic
1127217186 15:56835767-56835789 GGACTCCTGAATAATCTGGAAGG + Intronic
1127418039 15:58776330-58776352 TGTCTCCTGGAGAATGAGGTAGG - Intronic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1128511013 15:68313930-68313952 GGTCTGAGGCAGACTGTGGAAGG + Intronic
1128548504 15:68583153-68583175 TGGCTCCTGCTGAATGTGAAAGG + Intronic
1128890694 15:71329341-71329363 TGTCTGCGGCAGAATGTGGGAGG + Intronic
1130292461 15:82614783-82614805 AGTCTCTTGAAGAATGTGTAAGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130484970 15:84393855-84393877 GGTCTCCTGCAACATTTGGCGGG - Intergenic
1130744969 15:86641926-86641948 GGTCTACTTCAGACTGTGAAAGG + Intronic
1131831778 15:96359316-96359338 GATCTCCAAAAGAATGTGGAAGG - Intergenic
1134122974 16:11597763-11597785 GCTCTCCTTCAGACTGCGGAGGG - Intronic
1137031573 16:35528902-35528924 TGTCTCATGCAGAATGCAGATGG + Intergenic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137840385 16:51635977-51635999 GTTCTCTGGCAGAATTTGGAAGG + Intergenic
1138852954 16:60652065-60652087 GCTCTCCTACAGAAAGTGGAAGG - Intergenic
1141397476 16:83717806-83717828 GGTGTCCTGCAGAACGTGCACGG - Intronic
1145313824 17:21716642-21716664 GGTCTCCTGGAGCCTGTGGAGGG + Intergenic
1145371903 17:22313366-22313388 GGTCTCCTGCAGATAAGGGAGGG + Intergenic
1145712267 17:26988616-26988638 GGTCTCCCGGAGCCTGTGGAGGG + Intergenic
1147191071 17:38738554-38738576 GGCCCCCTGGAGAATGGGGATGG - Exonic
1147325241 17:39666842-39666864 TGTCTCGTGGAGAATATGGAGGG + Intergenic
1148227127 17:45906825-45906847 GGTCTGTTCCAGGATGTGGAGGG - Intronic
1148336802 17:46847540-46847562 GGTCACCTGGAGGATGGGGAAGG + Intronic
1151443007 17:74145739-74145761 GGTTTCCTGCAGAAAAGGGATGG + Intergenic
1151697955 17:75727634-75727656 GGTCTCCTGCAGCCAGTGGAAGG - Exonic
1151784985 17:76271069-76271091 TGTCTCCTGCTGAATGTGCAGGG + Exonic
1152282745 17:79395111-79395133 GGTCTCCGGCAGAAGGTTGACGG - Intronic
1154170201 18:12046069-12046091 GTTCTCCTGCAGTCTCTGGAGGG - Intergenic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156282360 18:35652377-35652399 TGTTTTCTGCAGTATGTGGAAGG + Intronic
1156825696 18:41427805-41427827 AGTCTCCTGCAGAGTATGGTGGG - Intergenic
1157597262 18:48871332-48871354 GGTATCCTGGAGTATTTGGAGGG - Intergenic
1157614461 18:48978445-48978467 GGTATCCTGGAGTATTTGGAGGG + Intergenic
1160104458 18:75959024-75959046 ATTCTCCTGCATAATGTGGTGGG - Intergenic
1164391144 19:27822355-27822377 TGTCTGCTGGAGAATATGGAAGG + Intergenic
1165096198 19:33411217-33411239 GGGCTCCTGCAGCAGGAGGATGG + Intronic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1166520918 19:43479529-43479551 GATCTCCGGCAGCATCTGGAGGG - Exonic
1166583899 19:43928356-43928378 GGTCTCCATCAGAGGGTGGAGGG + Intronic
1167006936 19:46782378-46782400 GGTCTCCTGGATCATGTGGTAGG - Exonic
1202712078 1_KI270714v1_random:24260-24282 GCCCTGCTGCAGACTGTGGAGGG + Intergenic
925778379 2:7356925-7356947 GGCCTCCTGTAGAATGTGAGGGG + Intergenic
927904980 2:26849207-26849229 GTTCTGCTGAAGAATGGGGAGGG + Intronic
928272276 2:29867100-29867122 AGTGTCTTGCAGAATCTGGAGGG - Intronic
928610651 2:32988716-32988738 GGACCTCTGCAGCATGTGGAAGG - Intronic
928877120 2:36053099-36053121 GTTCTCCTGCAGGAACTGGAAGG - Intergenic
930001400 2:46864167-46864189 GGCATCCCTCAGAATGTGGAGGG - Intergenic
930241244 2:48937699-48937721 GGTCTCTGGCAGAATTTGGAAGG - Intergenic
934531470 2:95091942-95091964 GGTATCATGCAGATTCTGGAAGG + Intronic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
940217110 2:151312906-151312928 GGTATCCAGAATAATGTGGAAGG - Intergenic
942504520 2:176627514-176627536 GGTGTCCTTCAGTATGTGAATGG + Intergenic
945704352 2:213210638-213210660 GGACTCATGAAGAATGAGGATGG - Intergenic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
1171437863 20:25136928-25136950 TGTGTCCAGCAGAATGTTGATGG - Intergenic
1172740334 20:37161510-37161532 GTTCTCCTTGAGTATGTGGAAGG + Intronic
1173427161 20:42953303-42953325 AGTCTTCTGCACACTGTGGATGG - Intronic
1175855681 20:62119731-62119753 GGTATCCTGCCCAAAGTGGAGGG - Intergenic
1176270277 20:64232615-64232637 GGACTCCATCAGGATGTGGAAGG - Intronic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179558438 21:42195348-42195370 CGTGTCCTGCTGGATGTGGATGG + Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1183700786 22:39449867-39449889 GGGGTGCTGCAGGATGTGGATGG - Intergenic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184639375 22:45861146-45861168 GGGCTCCTGCAGAGTGGGGTGGG + Intergenic
1185179448 22:49350636-49350658 GGTGCCCTGGAGGATGTGGAGGG - Intergenic
949238495 3:1840718-1840740 AGTCTCCTGCAAAATGGAGATGG + Intergenic
952884453 3:38003896-38003918 GGTCTCCGGCCCAAAGTGGAAGG - Intronic
953213775 3:40898689-40898711 GGTCTCAGGCTGAAGGTGGAAGG + Intergenic
953885360 3:46711938-46711960 TGGCTCCCGCAGAAGGTGGAGGG - Intergenic
954005781 3:47589312-47589334 GAGCTCCTTGAGAATGTGGAGGG - Intronic
954884608 3:53861473-53861495 GGTATTCTGCAAAATGTGCAAGG - Intronic
955397828 3:58569569-58569591 GGGCTCCTGGAGACTGAGGAAGG - Intronic
955624134 3:60898757-60898779 GGGCTCCTGAAGAATGTGAAGGG - Intronic
957734649 3:84189810-84189832 GGTCTCTGGAATAATGTGGAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965080536 3:164025612-164025634 GGTCTCCTGAAGGTTCTGGAAGG + Intergenic
965483041 3:169243912-169243934 GGTCTCCTGGAGACTTTTGAGGG - Intronic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
968920633 4:3520649-3520671 GGCCACCTGCAGACTGTGCAGGG + Intronic
969138297 4:5048799-5048821 AGTCTCCTCCAGAGTGGGGATGG + Intergenic
971553154 4:27979214-27979236 GGTATCCGGAATAATGTGGAAGG - Intergenic
972594178 4:40515857-40515879 GGTCTCCTACCTTATGTGGATGG + Intronic
975673404 4:76803832-76803854 GGTCTCCTCCAGAAGGAGGGAGG - Intergenic
977553390 4:98465508-98465530 GGGCCCCTGGGGAATGTGGAAGG - Intergenic
981348054 4:143698921-143698943 GTTCTCCAGCACAAAGTGGATGG + Exonic
982377110 4:154704959-154704981 GGTCTCCTTCAGTAGGTGAATGG + Intronic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985960027 5:3294292-3294314 TGGTTCCTGCAGAATGAGGATGG + Intergenic
986967377 5:13290630-13290652 GGTCCCCTTCAGAGGGTGGAGGG - Intergenic
987032160 5:13986138-13986160 GGTCTCCTGCCGGAGGCGGAGGG + Intergenic
987089597 5:14499044-14499066 GGTCTCATGTAGAATGTGCATGG + Intronic
988945400 5:36191640-36191662 TGTATCCTGCACATTGTGGATGG - Intergenic
989508953 5:42260929-42260951 GGTCTCCAGCAAAATGAGGAAGG + Intergenic
993450856 5:88070603-88070625 GGTCTGCTGCAGCTTGTTGAAGG - Intergenic
994247959 5:97502397-97502419 AGTCTCCTGGAGAAAGTAGAGGG - Intergenic
994295381 5:98082924-98082946 GGTATCCAGAATAATGTGGAAGG - Intergenic
995244442 5:109920662-109920684 GGGCTCCTGGGGCATGTGGAAGG + Intergenic
997877781 5:137564810-137564832 GCTCTCCTGGAGAATGTGTGGGG - Intronic
1000739632 5:164951798-164951820 AGTCTCCTCCAGACTGTGCAAGG + Intergenic
1006154559 6:32007252-32007274 GCTCTCCTGCAGAGGGTGAAAGG - Intergenic
1006160870 6:32039988-32040010 GCTCTCCTGCAGAGGGTGAAAGG - Exonic
1008311903 6:49986922-49986944 GGACTCATGGAGAATCTGGATGG + Intergenic
1011527575 6:88281956-88281978 GATTTCCTGGAGAAAGTGGAGGG - Intergenic
1015693898 6:135957839-135957861 GGTCTCCTTCACAAAGTGGGAGG - Intronic
1018891965 6:167989158-167989180 CTTCTCCAGCAGAACGTGGACGG + Intergenic
1021489678 7:21205464-21205486 GGTCTCAGGCAGAAAGTAGAAGG + Intergenic
1023062600 7:36343115-36343137 GGTTTCCTGCAGAATGTATTAGG - Intronic
1023212393 7:37821391-37821413 GTTCTCCTGCAGAATGGTGAGGG - Intronic
1025869989 7:65422502-65422524 TGTCTGCTGGAGAATATGGAAGG - Intergenic
1026244752 7:68609786-68609808 GGTCTCTTGCAGAATGAGATTGG - Intergenic
1029409249 7:100398294-100398316 GTTCCCCTGCTGAATGTGCAGGG + Intronic
1032555402 7:132827951-132827973 GGTATCCTGCAGAAAGGGGCAGG - Intronic
1033271932 7:139939802-139939824 GGAAACCAGCAGAATGTGGAAGG + Intronic
1033505613 7:141996834-141996856 GGTTTCCTGTGGAATGTGGGAGG + Intronic
1036790839 8:11718348-11718370 GGGCTCCTGCAAAATGCAGAAGG - Intronic
1037305359 8:17497750-17497772 GGTCCCCTGCAGAATGTGAAGGG - Intronic
1039438606 8:37578898-37578920 GGTCGCCTACAGAATCTAGAAGG - Intergenic
1039864511 8:41489889-41489911 GGTCACCTGAGGGATGTGGATGG + Intergenic
1044786075 8:95794487-95794509 GGTCTCCTGCCCCACGTGGAAGG + Intergenic
1045500442 8:102740527-102740549 GGTGTCCTGCAGATTTAGGAGGG + Intergenic
1046073246 8:109284025-109284047 GGTCTCTTGTAGAATGCCGATGG - Intronic
1048028440 8:130608370-130608392 GGTCTGATGGAGAATATGGACGG + Intergenic
1049005664 8:139854099-139854121 TTTCTCCTGTAGAATGTTGAAGG - Intronic
1050218034 9:3350662-3350684 GATGTCCTTCAGAAGGTGGACGG + Intronic
1050624806 9:7491819-7491841 GTTATCCTCCAGAATGTGGCTGG + Intergenic
1053553715 9:39111572-39111594 TGTCTCCTGCTGAATGAGGTAGG + Intronic
1053817824 9:41931713-41931735 TGTCTCCTGCTGAATGAGGTAGG + Intronic
1054108078 9:61075384-61075406 TGTCTCCTGCTGAATGAGGTAGG + Intergenic
1054612779 9:67255741-67255763 TGTCTCCTGCTGAATGAGGTAGG - Intergenic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1057600377 9:96451357-96451379 GGTGTCCTGCTGCCTGTGGACGG + Intronic
1057899444 9:98936759-98936781 ACTCTCCTCCAGAATGTGGTTGG - Intergenic
1060057911 9:120431615-120431637 GGCCCCCTCCAGACTGTGGAAGG + Intronic
1062651826 9:137581703-137581725 GGCCTGCTGCAGATGGTGGAGGG - Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186858219 X:13646165-13646187 GCTCTCCTGATGAATGTGAACGG + Intergenic
1186977014 X:14918298-14918320 GTTCTCCTGCAGAAAGTGGGAGG + Intronic
1187551117 X:20306812-20306834 GGGGTCTTGCACAATGTGGATGG + Intergenic
1189001327 X:36950253-36950275 GATATCCTTCAGAAGGTGGATGG - Intergenic
1189176808 X:38965891-38965913 GGACTCCTGCAAAATATGGCTGG - Intergenic
1189986880 X:46561447-46561469 GTTCTCGTGCAGAATCAGGAAGG - Intergenic
1192165285 X:68824039-68824061 GGTTACCTGGAGAATGTGCAAGG - Intergenic
1192452689 X:71253672-71253694 GGGCTCCTGCAGAGTGGGGAGGG - Intronic
1195730167 X:107959154-107959176 GGTCTGCTGCAGTTTGTGGGAGG + Intergenic
1196014279 X:110920811-110920833 GGTCTCCTGCAGAATCTACCAGG - Intergenic
1197750970 X:129963336-129963358 TGACTCCTGCAGAGTGAGGAGGG - Intergenic
1198510831 X:137349861-137349883 TGTTTCCTACAGAATGTGCAAGG + Intergenic
1199746672 X:150776072-150776094 GGTCTCAGGCAGGCTGTGGAGGG + Intronic
1199863059 X:151819474-151819496 GGTCTCATGCATCATTTGGAAGG + Intergenic
1201274883 Y:12287576-12287598 GGTCTCTAGCAGATTCTGGAAGG + Intergenic