ID: 1105888913

View in Genome Browser
Species Human (GRCh38)
Location 13:24668073-24668095
Sequence GGCTCACATGATTGTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105888913 Original CRISPR GGCTCACATGATTGTGAGAC TGG Intergenic