ID: 1105889368

View in Genome Browser
Species Human (GRCh38)
Location 13:24671181-24671203
Sequence ACGCTCTGCCCACTCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105889368_1105889371 27 Left 1105889368 13:24671181-24671203 CCTTGGGAGAGTGGGCAGAGCGT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1105889371 13:24671231-24671253 CAAGCCTGAAAGGCAGAATACGG 0: 1
1: 0
2: 2
3: 13
4: 226
1105889368_1105889370 17 Left 1105889368 13:24671181-24671203 CCTTGGGAGAGTGGGCAGAGCGT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1105889370 13:24671221-24671243 TTTAGCAAAACAAGCCTGAAAGG 0: 1
1: 0
2: 1
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105889368 Original CRISPR ACGCTCTGCCCACTCTCCCA AGG (reversed) Intergenic
900641390 1:3689572-3689594 CAGCTCTGCCCGCTCTCCCGGGG + Intronic
900690283 1:3976742-3976764 TCTCTCTGCCCACTCACCCCTGG - Intergenic
902637220 1:17742480-17742502 CTGCTCTGACCACTCACCCAGGG - Intergenic
904493259 1:30873081-30873103 CTTCTCTGCCCTCTCTCCCAAGG - Intronic
904529038 1:31155727-31155749 TCTCTCAACCCACTCTCCCAGGG - Intergenic
904869427 1:33607460-33607482 AAGCTCTGACCACTCTCCCCAGG - Intronic
905249566 1:36639203-36639225 GCGGGCTCCCCACTCTCCCATGG + Intergenic
905477869 1:38241656-38241678 CCCCTCTGCTCACTCTCCCAGGG + Intergenic
911875055 1:103150758-103150780 ATGCTCTACCCAATGTCCCATGG + Intergenic
912262049 1:108120340-108120362 AAGCTCTCACCACTCTCCCCAGG + Intergenic
913093943 1:115498551-115498573 TGTCTCTGCCCACTCCCCCAGGG - Intergenic
915287353 1:154861521-154861543 ACACTCTGCCCCCTCTCCCCGGG + Intronic
916214820 1:162385539-162385561 AAGCCCTGCTCACTCTACCAGGG - Intronic
916274291 1:162977157-162977179 ACGTTCTGCCCACACTCATAAGG + Intergenic
917516188 1:175710527-175710549 GCACTCTGCACTCTCTCCCAAGG - Intronic
919738955 1:200971162-200971184 ATTCTCTGCCCACTCTTTCAGGG - Intronic
923365695 1:233258614-233258636 ACGCTGAGCCCACTAACCCAGGG - Exonic
1063970549 10:11378613-11378635 ACCCTCTCCCCATTCTCCAAGGG + Intergenic
1069870761 10:71531572-71531594 AAGCCATGCCCACTTTCCCAAGG - Intronic
1074199395 10:111221267-111221289 AAGCTCTGCCCTGTATCCCAGGG - Intergenic
1074893420 10:117754181-117754203 ATGCTCTGCCCCATGTCCCATGG - Intergenic
1075760177 10:124849550-124849572 ACTCTGTGCCCACTCTCCCTGGG - Intergenic
1075966244 10:126614212-126614234 TCCCCCTGCCCACTTTCCCAAGG + Intronic
1076029791 10:127147599-127147621 ACACTCCTCCCAGTCTCCCAGGG + Intronic
1076607456 10:131698350-131698372 ACCCTCTGCCTCCTCCCCCATGG + Intergenic
1076770327 10:132659363-132659385 ACCCTCTGCCCATGGTCCCATGG - Intronic
1077042089 11:529337-529359 ACCCTCTGCCCACACCCACAGGG - Intergenic
1077398146 11:2336736-2336758 CCTCTCTGGCCACTCCCCCAAGG - Intergenic
1077721779 11:4637335-4637357 ACGCTCTGCTCAGACGCCCAAGG - Intergenic
1077867976 11:6238987-6239009 GCACTCTGCCCTGTCTCCCAGGG - Intronic
1081566519 11:44264204-44264226 ATCCTCTGCCCACTCTCTCCAGG + Exonic
1082807566 11:57460517-57460539 TCGCTGTCCCCACTCTCCCTCGG + Intergenic
1084438735 11:69158587-69158609 ACCCTCTGCACACTCTCTAACGG + Intergenic
1084991798 11:72932586-72932608 ACTCTCTGCTTTCTCTCCCATGG + Intronic
1085029110 11:73258866-73258888 AGGTTCTGCGCAGTCTCCCACGG + Intergenic
1086303953 11:85459902-85459924 ACACTCTGGCCACTTTTCCATGG + Intronic
1089054186 11:115571834-115571856 ACTCTCTGCCTGCTCTCCCTGGG - Intergenic
1089367444 11:117929641-117929663 AGGCTCTGCCCTTTCTCTCAGGG - Intergenic
1091308939 11:134559399-134559421 ACCCTCTGACAACTCTCCCCGGG - Intergenic
1091405231 12:204563-204585 AAGATCTGCCCCCTCTTCCAGGG - Exonic
1092786787 12:12033621-12033643 ACGCCCGGCCCACTTTCCCGTGG + Intergenic
1094057618 12:26282941-26282963 ACCCTCTCCCCATTCTGCCACGG + Intronic
1097107754 12:56635280-56635302 GAGCTCTGCCCGCGCTCCCAGGG + Intronic
1102957981 12:117071841-117071863 ACGCTCCACCCACTCAACCATGG + Intronic
1103918262 12:124386904-124386926 AGGGCCTGCCCACTTTCCCAGGG + Intronic
1104401857 12:128482881-128482903 CCCATCTGCCCACTCACCCAGGG - Intronic
1105751518 13:23425596-23425618 ACTCCCTGCCCGCTCTCCCCAGG - Intronic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1106621458 13:31374554-31374576 AAGCTCTACCCAGCCTCCCAGGG + Intergenic
1112194484 13:97211829-97211851 ATGTTCTGCCTATTCTCCCAAGG - Intergenic
1112448273 13:99487006-99487028 CTGCTCTGCCCACTCTCACATGG - Intergenic
1113531405 13:111030131-111030153 ATGCTGTGCCCACACACCCAGGG - Intergenic
1114408519 14:22478789-22478811 GGGCTCCACCCACTCTCCCAGGG - Intergenic
1114494922 14:23126037-23126059 ATGCTCTCCTCAGTCTCCCAGGG + Exonic
1117131800 14:52695061-52695083 ACACTGTGCACACTCTCCCCGGG + Intronic
1119677439 14:76566397-76566419 TTGTTCTGCACACTCTCCCAGGG - Intergenic
1121760438 14:96440424-96440446 ACCCTCTGCTCTCTCTCCCTTGG + Intronic
1122663222 14:103311721-103311743 ACACTCAGGCCACTCTTCCATGG + Intergenic
1124833910 15:33177019-33177041 ACGTACTGGCCACTCTTCCAAGG + Intronic
1125527379 15:40385686-40385708 GCACTCTGCACACTCTCCTAAGG - Intronic
1127045759 15:55023863-55023885 GGGCTCTGCCCTCTCTCCTAGGG - Intergenic
1127959920 15:63883014-63883036 CCGTTCTGCCCACTTTCCCTTGG - Intergenic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128766253 15:70252955-70252977 CCTCCCTGCCCACTCTCCCCAGG + Intergenic
1129271837 15:74423040-74423062 ACTCTCTGCCCACTTTCAAAAGG - Intronic
1131602455 15:93863280-93863302 ATGCTATGCCCACTCCCACAAGG - Intergenic
1133107332 16:3521015-3521037 ACACCCTGCCCACTGTCCCGAGG + Intronic
1135496605 16:22956920-22956942 ACTCTCTTCCCTCTCTCCCCAGG - Intergenic
1137606427 16:49789663-49789685 AGGCTTTGCCCCCTCTCCCCTGG - Intronic
1138095038 16:54204953-54204975 CCGCTCTGCCCAGCCTGCCATGG - Intergenic
1138561029 16:57801290-57801312 ACCTTCTGCCTGCTCTCCCAGGG - Intronic
1138577872 16:57920151-57920173 GCACTCGGCCCTCTCTCCCATGG - Intronic
1139310134 16:66021186-66021208 CAGCTCTGCCTACCCTCCCATGG + Intergenic
1139488108 16:67270806-67270828 TCCCCCTGCCCACTCTTCCAGGG - Exonic
1139507583 16:67406924-67406946 AGGATCTGCCCTCTCCCCCACGG + Intronic
1139598112 16:67969618-67969640 ACCCTCTGACCCCTCCCCCAGGG + Intergenic
1140344131 16:74195768-74195790 ACGCTCTGTGCACCCTCTCACGG + Intergenic
1140473817 16:75228815-75228837 AGGCTCTGCCCTGGCTCCCAGGG + Intronic
1141164162 16:81649232-81649254 AGCCTCTGCAGACTCTCCCATGG + Intronic
1141552671 16:84816660-84816682 GCCCTCTGCCCACTCTCTCTTGG - Intergenic
1142753977 17:2004671-2004693 ACCCTCTGCCCTCTCTGCCCAGG - Intronic
1143392595 17:6568596-6568618 TCTCTCCTCCCACTCTCCCATGG + Intergenic
1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG + Intronic
1147401073 17:40180292-40180314 ACGCTCCGCTCATTCTCCCCTGG + Intronic
1148145602 17:45362706-45362728 AAGATCTGCCCTCTCCCCCAGGG - Intergenic
1148774998 17:50090265-50090287 TGGCTCTGCCCCCTCCCCCATGG + Intronic
1151470181 17:74313194-74313216 TCGCTCTGTCCACTCTATCAGGG - Intronic
1151499902 17:74481889-74481911 CCCTTCTGCCCACCCTCCCAGGG - Intronic
1152308955 17:79537707-79537729 ACCCTCTCCCCAGTCCCCCAAGG + Intergenic
1154405238 18:14084580-14084602 AAGCTCTGCCCACCCTCCCCTGG - Intronic
1156481706 18:37440431-37440453 AGGCTCAGCCCGCTGTCCCAGGG + Intronic
1157040976 18:44038431-44038453 ACACTATGCCCTCTCTCCTAAGG - Intergenic
1157096374 18:44688976-44688998 ATACACTGCCCACTCTCCCAGGG - Intronic
1160558678 18:79742324-79742346 ACCCTCAGGCCTCTCTCCCATGG - Intronic
1163821656 19:19499611-19499633 ATGCTCTCCCCACTCTCTTAGGG + Intronic
1165060249 19:33201611-33201633 ACTCTCTCCTCACTCTCCCATGG - Intronic
1166254823 19:41596035-41596057 ACCCTCTGATCACTTTCCCATGG + Intronic
1166396659 19:42446177-42446199 ACCCACTGCTCACTTTCCCACGG - Intergenic
1166412655 19:42566563-42566585 ACCCTCTGGTCACTTTCCCATGG - Intergenic
1167490816 19:49792012-49792034 ACGCGCCGTCCACTCGCCCATGG - Exonic
1168267964 19:55232475-55232497 AGGCTCAGCCCACTTCCCCAGGG - Intronic
925451146 2:3969996-3970018 AGGCACTGCCCACCCTCACAGGG + Intergenic
927184750 2:20474078-20474100 AGGCTCAGCCCACCCTCTCAGGG + Intergenic
930804224 2:55473972-55473994 ACCCTCCGGCCACTCTCCCCCGG - Intergenic
932541992 2:72664768-72664790 ACGCTGTGCACACACTCCTATGG - Intronic
936251273 2:110870045-110870067 CCGCCCTCCCCACTCCCCCATGG - Intronic
937521710 2:122720534-122720556 CCCCTCTGGCCACCCTCCCAAGG - Intergenic
940255493 2:151724058-151724080 ACCCTCTCCCCACTCTGCCTAGG + Intronic
941012492 2:160317057-160317079 ACGCTCTATTCACTGTCCCAAGG + Intronic
942117461 2:172742048-172742070 ACGCGCTCCCCACTCCCCCCAGG + Intronic
945359396 2:208878870-208878892 ACGTTCTGCCCACCCCACCATGG - Intergenic
947664258 2:231893527-231893549 TCACTCTGCCCACACTCCAATGG - Intergenic
948178512 2:235962168-235962190 ACCCACTTCCCACTCTCCAAGGG - Intronic
948836885 2:240630211-240630233 CCGCTGTGCCAGCTCTCCCAGGG + Exonic
948916856 2:241038862-241038884 AAGCTCTGCCCAGTCACCCTTGG - Intronic
1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG + Intronic
1173021950 20:39274391-39274413 CCTCTCAGACCACTCTCCCAAGG + Intergenic
1175498663 20:59433656-59433678 TCTCCCTTCCCACTCTCCCAGGG - Intergenic
1175773194 20:61636598-61636620 AGGCTCTGGCCTCTCTTCCACGG + Intronic
1176145527 20:63563718-63563740 GGGCTCTGCCTACTCTGCCAGGG - Exonic
1176388524 21:6151613-6151635 ACGCTGTGCCCACCCACCCCAGG + Intergenic
1176870353 21:14078892-14078914 ACGCTCTGGCCGCCCGCCCACGG - Intergenic
1178997209 21:37414168-37414190 ACCATCAGCCCAATCTCCCAAGG - Intronic
1179734948 21:43386635-43386657 ACGCTGTGCCCACCCACCCCAGG - Intergenic
1180142698 21:45901944-45901966 AGCCTCTGCCCATTCTCCCTTGG - Intronic
1180982628 22:19886052-19886074 CCGCGCAGCCCACTCTCCCCTGG - Intronic
1181500480 22:23313113-23313135 AAGCTGTGCCCCCTCTGCCATGG + Intronic
1183830982 22:40418320-40418342 ACGCTCTTCCCACCCTCCTCTGG + Intronic
1184617038 22:45645466-45645488 CTGCTCTGCCCACCCTCCCTGGG - Intergenic
1184883703 22:47328938-47328960 ACTCCCAGCCCACACTCCCAGGG - Intergenic
950967405 3:17155790-17155812 ACTCTCTTCCCACTCACCCCTGG + Intergenic
951160054 3:19408015-19408037 ACTCTCTGCTCACTCTCCAAGGG - Intronic
951870356 3:27355251-27355273 TCTATCTGCCCCCTCTCCCAAGG + Intronic
953666561 3:44930012-44930034 ATGCACTGCCCCCGCTCCCAGGG + Intronic
953796685 3:45991539-45991561 ATGCTCTGCTCCCTCTGCCAAGG + Intronic
954800277 3:53183270-53183292 ACCCTCTCCCCACCCTCCCTGGG + Intronic
956745887 3:72310789-72310811 CTGCTCTGCCAACTCTCCCCTGG - Intergenic
956869149 3:73399400-73399422 AAATTCTGCCCACTCCCCCAGGG + Intronic
957037711 3:75310492-75310514 ACACTCAGGCCACCCTCCCAAGG - Intergenic
961085745 3:124066045-124066067 ACACTCAGGCCACCCTCCCAGGG - Intergenic
967204092 3:187103554-187103576 AAGCTCTGCCCCCTCCCCTATGG - Intergenic
969870846 4:10103792-10103814 TCCCTCCTCCCACTCTCCCAAGG + Intronic
977551427 4:98447811-98447833 AAGCCCTCCCCACTCTCCCGAGG + Intergenic
978778017 4:112521789-112521811 ATGGGCTGCCCACTCTCCAATGG + Intergenic
981511812 4:145566166-145566188 AGGCTCTGCTCACTCCCACAGGG + Intergenic
981557408 4:146009806-146009828 ATGCTCTGCAGACTCTCCCAAGG - Intergenic
982165029 4:152606418-152606440 ACGTTCTTCCAGCTCTCCCAAGG - Intergenic
983917446 4:173307825-173307847 AAGCTCTGCCAATTCTCCCATGG - Intronic
989199858 5:38752480-38752502 AGGCGCTGCCCACTCTAGCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990322092 5:54640101-54640123 ACCCTTTGCCCATTCTGCCAGGG - Intergenic
993480124 5:88414566-88414588 AAACATTGCCCACTCTCCCAGGG - Intergenic
998382887 5:141738195-141738217 ACTCTCTTCCCAAACTCCCAGGG + Intergenic
1000397230 5:160788572-160788594 ACCCTCTGGACTCTCTCCCAGGG - Intronic
1001982169 5:176044898-176044920 ACTCTCTACACACTCTCCCCAGG - Intergenic
1002235292 5:177799159-177799181 ACTCTCTACACACTCTCCCCAGG + Intergenic
1007610797 6:43147553-43147575 AGGCTCTGCCCTTTCTCCCAGGG + Intronic
1011215939 6:85005652-85005674 TAGCTCTGCCCACTTTCCCCGGG - Intergenic
1017825232 6:158076798-158076820 ACCCTCTGCCGACTCTCGAACGG - Intronic
1019650869 7:2157541-2157563 ACCCTCTGCCCTGTGTCCCAGGG - Intronic
1020005407 7:4781459-4781481 ATGCTCTGTCCACTGGCCCAAGG + Intronic
1024843214 7:53611753-53611775 ACCCTCAGCCCATTTTCCCAGGG + Intergenic
1024889021 7:54180195-54180217 ATGCTGTGCCCCCTTTCCCATGG - Intergenic
1026132243 7:67630182-67630204 AGTCTCTGCCCACTGTCCAAGGG - Intergenic
1028762249 7:94509658-94509680 ACTCTCTCCCCACACCCCCATGG + Intronic
1029090025 7:98040763-98040785 TCCCTGTCCCCACTCTCCCAAGG + Intergenic
1029405540 7:100372477-100372499 AGGCTCTGCCCACCCTCTCCAGG - Intronic
1029539307 7:101173429-101173451 ACGCCCTTCCCGCGCTCCCAGGG + Exonic
1032882324 7:136102967-136102989 CTGCTCTGCCCACTACCCCATGG + Intergenic
1035598083 8:877353-877375 ACTCTCTGCCCTGTCCCCCATGG + Intergenic
1037767191 8:21779482-21779504 ACCCGCTGCCCAGTCTCCCTTGG + Intronic
1039734830 8:40320704-40320726 ACATTCTGCCAACTTTCCCATGG + Intergenic
1040517158 8:48144523-48144545 ATTTTCTGCCCACTCTCCCACGG - Intergenic
1042046947 8:64664008-64664030 ACGCTCTGCCCCCTCCAGCAGGG + Intronic
1042393976 8:68269431-68269453 AGCCTCTCCCCACTCTCTCAGGG - Intergenic
1043923802 8:86014301-86014323 CCTCTCTGCCCAGACTCCCAGGG + Intronic
1047443426 8:124899432-124899454 CCTCTCTGGCCACTCCCCCAAGG - Intergenic
1048219031 8:132524669-132524691 ACCATCTGCCCAATCTCCCAAGG + Intergenic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1055937446 9:81616092-81616114 AAGCCCTGCCCACTCGCCCCGGG - Exonic
1056740595 9:89251202-89251224 TCTCTCTGCCCACCCTCCCATGG + Intergenic
1061578586 9:131523005-131523027 ACGCTGCGCCCACTCACCTACGG + Exonic
1061678995 9:132233395-132233417 ACAATCTGCCCAGCCTCCCACGG - Intronic
1062475433 9:136724454-136724476 ACGCTCTCCCCAGTAGCCCAGGG + Intergenic
1186161207 X:6778802-6778824 ACGCTCTCCCCGTTCTTCCACGG - Intergenic
1186310509 X:8312788-8312810 ACCCTCTGCACAGTCTCACAAGG + Intergenic
1188860057 X:35244891-35244913 ACACACTGCCCACCCTGCCAAGG - Intergenic
1194345420 X:92757307-92757329 AGGCTCTGCACAATCACCCAGGG - Intergenic
1195847255 X:109241690-109241712 CCTCTCTGGCCACTCCCCCAAGG + Intergenic
1198416614 X:136426386-136426408 CACCTCTGCCCTCTCTCCCAGGG - Intergenic
1200653764 Y:5873957-5873979 AGGCTCTGCACAATCACCCAGGG - Intergenic