ID: 1105889565

View in Genome Browser
Species Human (GRCh38)
Location 13:24672827-24672849
Sequence GGGTGTACTGAGTTTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105889560_1105889565 -3 Left 1105889560 13:24672807-24672829 CCCTCACATGAACCAGGAGAGGG 0: 1
1: 0
2: 0
3: 26
4: 161
Right 1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 71
1105889562_1105889565 -4 Left 1105889562 13:24672808-24672830 CCTCACATGAACCAGGAGAGGGT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 71
1105889556_1105889565 6 Left 1105889556 13:24672798-24672820 CCTTTTTTCCCCTCACATGAACC 0: 1
1: 0
2: 1
3: 22
4: 234
Right 1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 71
1105889554_1105889565 18 Left 1105889554 13:24672786-24672808 CCCATAAATTTACCTTTTTTCCC 0: 1
1: 0
2: 3
3: 44
4: 525
Right 1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 71
1105889555_1105889565 17 Left 1105889555 13:24672787-24672809 CCATAAATTTACCTTTTTTCCCC 0: 1
1: 0
2: 3
3: 60
4: 486
Right 1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 71
1105889558_1105889565 -2 Left 1105889558 13:24672806-24672828 CCCCTCACATGAACCAGGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG 0: 1
1: 0
2: 1
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105889565 Original CRISPR GGGTGTACTGAGTTTAAGCT GGG Intergenic
902275250 1:15334939-15334961 GCGTGGACTGAGTTGCAGCTTGG - Intronic
910799056 1:91127720-91127742 GGGTGAGCTAAGTTTAAGCAAGG - Intergenic
912429306 1:109620692-109620714 GGGAGGACTGTGTTTGAGCTTGG + Exonic
919588365 1:199467880-199467902 AGGTGTACTTAGTTTACACTTGG + Intergenic
921622444 1:217340736-217340758 TGGAGTACAGAGTTTAAGCTGGG - Intergenic
1073316743 10:102586821-102586843 GTGGGTACAGAGTTTAAGTTGGG - Intronic
1075389857 10:122084382-122084404 GGCTGTGCTGAGTGTGAGCTGGG - Exonic
1078407025 11:11079352-11079374 TGGTGAACTCAGTTTGAGCTAGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1091042000 11:132289984-132290006 GGCTGTTCTAAGTTTAAGCCAGG + Intronic
1091655461 12:2343113-2343135 GGGTGTCCTGATTCTAGGCTGGG + Intronic
1093784771 12:23179476-23179498 GGGTTTTCTGAGTTTGTGCTGGG + Intergenic
1103122176 12:118389400-118389422 GGGTGGACTGAGTGAAAGATGGG + Intronic
1105310154 13:19199482-19199504 GGCTTTACCGAGTTTACGCTGGG - Intergenic
1105889565 13:24672827-24672849 GGGTGTACTGAGTTTAAGCTGGG + Intergenic
1108140157 13:47411974-47411996 GGGTTTACTTTGTTTAAGGTGGG + Intergenic
1123482343 15:20643946-20643968 GAGTTTACTGAGTTTGAGCATGG + Intergenic
1131535200 15:93231605-93231627 GGGTGTCCTGAGTCTAAGCTGGG + Intergenic
1132668770 16:1094356-1094378 GGCTGTACTAAGGTTAGGCTTGG - Intronic
1137509422 16:49085932-49085954 GGCTGTAAGGAGTTCAAGCTGGG - Intergenic
1139325554 16:66150157-66150179 GAGTGTCCTCAGTTTAAGATGGG - Intergenic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1143887014 17:10072350-10072372 GAGTGGACTAAGTTAAAGCTGGG - Intronic
1147268085 17:39246969-39246991 GGGTGTCCTGTCTTTAAACTGGG + Intergenic
1158715143 18:59872164-59872186 GGCTGAAATGACTTTAAGCTTGG + Intergenic
932977080 2:76615744-76615766 GGTTGTACTGAGCTAAAACTGGG - Intergenic
934119674 2:88827498-88827520 GGGTGTCCTGAGTTTGGCCTGGG - Intergenic
935455376 2:103261455-103261477 TGGAGGACTGAGTTTAACCTTGG - Intergenic
936163139 2:110100038-110100060 GGGTGTCCTGAGTTTGGCCTGGG - Intronic
941901879 2:170686623-170686645 ATGTGTACTGAGTTTCAGTTTGG + Intergenic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
948486397 2:238283945-238283967 GGGTGGCCTGGGTTTCAGCTGGG + Intronic
1169791056 20:9411172-9411194 GGGGCTACAGAATTTAAGCTGGG + Intronic
1175247659 20:57591443-57591465 TGGTGTGCTGAGTTTTGGCTGGG + Intergenic
1177598423 21:23278475-23278497 AGATGAACTGAGTTTATGCTAGG - Intergenic
956235300 3:67063306-67063328 GGGTGTAGTGAGATGAAGTTGGG + Intergenic
957384134 3:79473136-79473158 AGGTGTCTTGTGTTTAAGCTGGG + Intronic
967908134 3:194518851-194518873 GGTTGGACTGGGTTTAAGTTTGG - Intergenic
968819748 4:2841891-2841913 ATGGGTACAGAGTTTAAGCTTGG - Intergenic
971646460 4:29212255-29212277 GGGTGTACTAAGTTTTTGCTTGG - Intergenic
978416147 4:108478318-108478340 GGCTGATCTGAGTTTAAGGTAGG - Intergenic
978461402 4:108957364-108957386 TGGTGTATTCAGTTTAGGCTGGG + Intronic
980428443 4:132658189-132658211 GGCTGTGGTGAGTTTTAGCTGGG + Intergenic
980644065 4:135618981-135619003 GGGTAAGCTGACTTTAAGCTGGG + Intergenic
982967378 4:161929697-161929719 GTGTGTACATAGTTTAAACTTGG + Intronic
986652500 5:9978739-9978761 GGGTGAATTCAGGTTAAGCTGGG - Intergenic
995126755 5:108584608-108584630 GGGTGCCCTGTGTTTTAGCTTGG - Intergenic
996438297 5:123460139-123460161 GGCAGTACAGAGTTTAAGCAGGG - Intergenic
997752593 5:136361679-136361701 GGCTGAATTGATTTTAAGCTTGG - Intronic
999569639 5:152905098-152905120 GGGTGTACAGTATTTGAGCTAGG - Intergenic
1000521420 5:162299680-162299702 AGGAGTACTGAGTTGAGGCTTGG - Intergenic
1002220523 5:177676444-177676466 ATGTGTATTGAGTTTCAGCTTGG + Intergenic
1008057294 6:46958394-46958416 GTGTGTACAGAGTTTCAGTTAGG + Intergenic
1010165847 6:72914258-72914280 GCGCTTACTCAGTTTAAGCTGGG + Intronic
1013472186 6:110475842-110475864 GGGTGTACGGAGGTTAAACGTGG + Intronic
1020667699 7:11068556-11068578 AGGGGTACAGAGTTTCAGCTGGG + Intronic
1022250229 7:28600097-28600119 GGGGGTACTGAATTGAAGGTGGG - Intronic
1026271112 7:68837857-68837879 GGGTGTACTGAGGTTCACCCGGG + Intergenic
1026582548 7:71630338-71630360 GGATGTTCTGAGTTTATCCTTGG - Intronic
1027765504 7:82335861-82335883 AAGTATACTGAATTTAAGCTAGG + Intronic
1030042315 7:105462936-105462958 GGGTGTACTGAGCTTTGGTTTGG + Intronic
1030925819 7:115453112-115453134 AGGTGAACTGTGTTTATGCTAGG + Intergenic
1036690441 8:10941491-10941513 GTGTGAGCTGAGGTTAAGCTCGG + Intronic
1045101675 8:98850783-98850805 GGGGGTTCAGAGTTTAACCTGGG + Intronic
1051605390 9:18913166-18913188 GGGTGTTCTGAGTTGAGTCTAGG - Intergenic
1052775455 9:32728401-32728423 GGGTGTGTTGAGTTTTAGGTCGG - Intergenic
1055723519 9:79201946-79201968 TGGTGTACTGTTTTTAACCTGGG - Intergenic
1185725564 X:2418904-2418926 GGGGGTTCTGAGATTTAGCTTGG - Intronic
1188029277 X:25246585-25246607 GGGTGTAATGATTTTATGTTGGG + Intergenic
1188994439 X:36865844-36865866 GGGTATTATGAGTGTAAGCTGGG + Intergenic
1192138621 X:68629871-68629893 GGGTCTACTGAGTGGATGCTGGG - Intergenic
1192147156 X:68689421-68689443 GGGTCTACTGAGTGGATGCTGGG + Intronic
1195287248 X:103397035-103397057 GGGAGGAATGAGTTTAAGCAGGG + Intergenic
1195947233 X:110228229-110228251 GGCTGTTTTGAGTTTCAGCTAGG - Intronic
1197665184 X:129215691-129215713 TGGTGTACTGAGTTCAGGCCAGG + Intergenic