ID: 1105892300

View in Genome Browser
Species Human (GRCh38)
Location 13:24690388-24690410
Sequence GCTGGTGGTGGGGGACATTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 569}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105892289_1105892300 13 Left 1105892289 13:24690352-24690374 CCGAGATTCCGAGAAGAAGACCA 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG 0: 1
1: 0
2: 4
3: 71
4: 569
1105892292_1105892300 -7 Left 1105892292 13:24690372-24690394 CCATCCCTTCAGAGCAGCTGGTG 0: 1
1: 0
2: 1
3: 63
4: 492
Right 1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG 0: 1
1: 0
2: 4
3: 71
4: 569
1105892290_1105892300 5 Left 1105892290 13:24690360-24690382 CCGAGAAGAAGACCATCCCTTCA 0: 1
1: 1
2: 0
3: 16
4: 163
Right 1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG 0: 1
1: 0
2: 4
3: 71
4: 569

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105892300 Original CRISPR GCTGGTGGTGGGGGACATTG TGG Exonic
900334337 1:2154107-2154129 GCTGCTGGTGAGGGCCACTGGGG + Intronic
900358969 1:2278854-2278876 GGTGGTGGTGGGGGGTGTTGGGG + Intronic
900473193 1:2864413-2864435 GCGGGTGGTGGGGGGGATTGGGG + Intergenic
900508084 1:3039583-3039605 GCTGGTGTTGGAGGTCATGGTGG + Intergenic
901022946 1:6264205-6264227 CCAGGGGGTGTGGGACATTGGGG - Intergenic
901133123 1:6975173-6975195 GGTGGTGGGGGGAGACAGTGTGG - Intronic
901642648 1:10700743-10700765 GCTGATAGTGGGGGACAGAGAGG + Intronic
901842824 1:11964586-11964608 GCTGGTGGTGGGGAAGATGGAGG - Intronic
902045166 1:13518612-13518634 CCTGGAGGTGGGGATCATTGGGG - Intergenic
902573044 1:17359209-17359231 GGTGGGGGTGGGGGACAGTGTGG - Intronic
902610192 1:17592621-17592643 GCTAGGTGTGGGGGACATAGGGG + Intronic
903333326 1:22608709-22608731 GCTGGGGGAGGGGGGGATTGGGG + Intergenic
903440021 1:23380718-23380740 GCTGGCTGTGGGGGCCTTTGAGG - Intergenic
903753689 1:25646214-25646236 GCTTGTGGTGGAGGACCCTGTGG + Intronic
903774059 1:25781687-25781709 GGGGGTGGTGGGGGAGATAGGGG - Intronic
904727534 1:32561061-32561083 GGTGGGGGTGGGGGACATTAAGG - Intronic
904910684 1:33932003-33932025 GCTGGTGCAGAGGGACATGGGGG + Intronic
905037726 1:34929104-34929126 GCTGGTTGTGGGGGAAGTCGTGG - Intronic
905587922 1:39136135-39136157 TCTGGTGGTGGGCTGCATTGAGG - Intronic
905798903 1:40831019-40831041 GCTGGGGGTGGGGGTGAGTGGGG - Intronic
906096479 1:43227702-43227724 GCGTGTGGTGGGGGGCATGGGGG - Intronic
906141707 1:43537630-43537652 GCAGGTAGTCTGGGACATTGTGG + Intronic
906787084 1:48625486-48625508 GCTGCGGCTGGGGGACAGTGAGG + Intronic
907287162 1:53389356-53389378 GCTGGGGGTGGGGGGAAGTGTGG + Intergenic
908464327 1:64376695-64376717 GCTGGCGGTGGGGGGAAGTGGGG - Intergenic
908654370 1:66372436-66372458 AGTGGTGGTGAGGGACTTTGAGG - Exonic
910411558 1:86951645-86951667 GCTGGAGGTGGGGGTGACTGTGG + Intronic
911632347 1:100197401-100197423 TCTGATGGTGGGGGGCAGTGAGG + Intronic
911699953 1:100941255-100941277 TCTGGTGGTGGTGGATATGGTGG - Intronic
912031249 1:105247281-105247303 GTTGGTGGTGGGGGAAAGTGGGG + Intergenic
912702435 1:111888233-111888255 GCTGGAGGTGGTGGGGATTGTGG + Intronic
913403975 1:118467748-118467770 ACTGGAGGTAGGGGACAGTGAGG + Intergenic
913491454 1:119383625-119383647 GGTGGTGGTGGTGGAGAATGTGG - Intronic
913959140 1:143326267-143326289 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
914053457 1:144151647-144151669 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
914125740 1:144814894-144814916 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
915459203 1:156059704-156059726 GCTGGTAGGGGGGTACACTGGGG - Intergenic
916074734 1:161193795-161193817 GCTGGTGGCTGGGGTCCTTGGGG - Exonic
916273588 1:162969687-162969709 GCTGGTGGTGGGCGTTGTTGTGG + Intergenic
916289271 1:163146651-163146673 GCAGGTGGAGGGGGCCAGTGAGG + Intronic
917491262 1:175500531-175500553 GCTGGTGCTGGGTGACCTTGGGG + Intronic
918006504 1:180546393-180546415 GCTGGTGAGGGGTGACAGTGGGG + Intergenic
920016310 1:202912461-202912483 GGTGGTGGTGGTGGATATGGTGG + Intronic
920092712 1:203465664-203465686 GCTGATGGTGTGGGAAAGTGGGG - Intergenic
920609735 1:207424738-207424760 CCTGGGGGTGGGGGACCTTCAGG - Intergenic
921564988 1:216706047-216706069 GCTGGGGGTGGGGGACGAGGAGG - Intronic
922785956 1:228282309-228282331 GCTGGTGGGGGGGGCTTTTGGGG + Intronic
923333572 1:232947580-232947602 GCTGGGCGTGGGGGACATCCAGG + Intergenic
1062817433 10:510877-510899 GCTGGTGGTGTGGGACAGCCAGG + Intronic
1063982117 10:11462793-11462815 ACTGGTGCTGGGGGATATTCGGG - Exonic
1064553304 10:16523213-16523235 GCTGGGGGGCGGGGAGATTGAGG - Intergenic
1065240121 10:23695712-23695734 GCTGGAGGGTGGGGACACTGGGG + Intronic
1066046362 10:31598928-31598950 GCTGGAGGTGGGGCCCAGTGGGG + Intergenic
1066139828 10:32493160-32493182 GCTGGGGTTGGGGGAAAATGCGG - Intronic
1066393298 10:34996118-34996140 GCTGGTGGTGGGGAATGTGGAGG + Intergenic
1067282137 10:44880741-44880763 GCTGTTGATGGGGGAGATGGTGG + Intergenic
1067299966 10:44999205-44999227 GCTGGTGGTTGGAGAGTTTGGGG - Exonic
1068044463 10:51868329-51868351 GCTGGAGGTGGGGGAAAATAAGG + Intronic
1070148197 10:73789643-73789665 GCTGGAGCTGGGGGACAGAGAGG - Intronic
1070751287 10:78965378-78965400 GCTGGTGGGGAGGGCCCTTGGGG + Intergenic
1070884109 10:79874769-79874791 GCTGGTGGGGTGGGACAGGGAGG - Intergenic
1071137548 10:82469468-82469490 GGTGGTGGTGGTGGTCATGGTGG + Intronic
1071650663 10:87391069-87391091 GCTGGTGGGGTGGGACAGGGAGG - Intergenic
1072549095 10:96463620-96463642 GCAGGGGGAGGGGGACACTGGGG + Intronic
1073084958 10:100882420-100882442 GCTGGTGGGGAGGGGCAGTGAGG + Intergenic
1073201918 10:101742292-101742314 CCTAGGGCTGGGGGACATTGAGG + Intergenic
1073476344 10:103756430-103756452 GGTGGTGGAGGGGAACACTGAGG - Intronic
1073801217 10:107043704-107043726 GCTGGTGGTGGTGAAACTTGAGG - Intronic
1077108933 11:853646-853668 CCTGGTGGTGGGGGACCCGGTGG + Intronic
1077283106 11:1754340-1754362 GGTGGTGGTGAGGGGCATGGAGG + Intronic
1077584034 11:3436763-3436785 GCGGGGGGTGGGGAACATTTGGG + Intergenic
1077587398 11:3464158-3464180 ACTGGTGGAGGGGGGCAATGGGG - Intergenic
1078521359 11:12066420-12066442 CCAGGAGGTGGGGGTCATTGGGG + Intergenic
1078591113 11:12641197-12641219 GGTGGTGGTGGGGGATGTGGTGG - Intergenic
1079056765 11:17212896-17212918 GCAGGAGGTGGGGATCATTGGGG + Intronic
1079182357 11:18204799-18204821 GCTGGTGGTGGCAGGCATTCTGG - Intronic
1079952187 11:26819360-26819382 GCTGTTGGTGGGGGACGTGGTGG - Intergenic
1080124446 11:28715913-28715935 GCTGGTGGACGGGGGCATAGTGG - Intergenic
1080979648 11:37385891-37385913 GCTGGTGGTGGGGGGCGGGGGGG + Intergenic
1082184539 11:49163494-49163516 GGTGGTGGTGGGGGGCAGGGAGG - Intronic
1082687051 11:56252421-56252443 GCTGGTTGTGTTGGTCATTGAGG + Exonic
1082891796 11:58147020-58147042 GCTGGTGGTGGTGGAGTTGGAGG + Intronic
1083773860 11:64883646-64883668 GCTGAGGCTGGGGGACAATGGGG - Intronic
1084198312 11:67539008-67539030 GCTGGTGCTCTGGGACAATGTGG + Intergenic
1084240941 11:67819432-67819454 GCGGGGGGTGGGGAACATTTAGG + Intergenic
1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG + Intronic
1084437971 11:69155174-69155196 GCTGATGGTGGGGGGACTTGGGG + Intergenic
1084466020 11:69323500-69323522 GGTGATGGTGGTGGAAATTGGGG + Intronic
1084701202 11:70787326-70787348 GGTGGTGGTGGTGGTCATGGTGG - Intronic
1084829593 11:71758782-71758804 ACTGGTGGAGGGGGGCAATGGGG + Intergenic
1084831498 11:71773274-71773296 GCGGGGGGTGGGGAACATTTAGG - Intergenic
1085040794 11:73325211-73325233 GCTGGGGGTGGGGGAGGTTTGGG - Intronic
1085398991 11:76224359-76224381 GTTGGGGGTGGGGGACAGCGGGG + Intergenic
1085614385 11:77984536-77984558 GCTGGAGGTGGGGGTGATGGAGG + Intronic
1086020367 11:82221437-82221459 GCTGATGGTAGGGGAAAGTGGGG - Intergenic
1086487683 11:87326118-87326140 GCTGGGGGTGGGGGAGAGTATGG - Intergenic
1087022444 11:93616858-93616880 GCTGGTGATGGGGGTGACTGTGG - Intergenic
1087108197 11:94433146-94433168 GCTGGTGGTAGGTGAAATGGAGG - Intronic
1087370580 11:97279190-97279212 GCTGCTGCTGAGGGACATGGGGG - Intergenic
1088144495 11:106659373-106659395 GACGGTGGTGGGGGAGAATGCGG - Intergenic
1089973096 11:122710334-122710356 GCTGGTGGTTGGAGAGATGGTGG + Intronic
1090231949 11:125113706-125113728 GCTGGTGGAGAAGGACACTGAGG - Intergenic
1090276629 11:125424634-125424656 GCTGGTGGAGCGGGGCATGGAGG - Intronic
1090889217 11:130908062-130908084 GATGGTGGTGAGTGCCATTGTGG - Exonic
1091215505 11:133898972-133898994 GCTGCTGGTTGGTGACAGTGGGG + Intergenic
1091270553 11:134308514-134308536 GGTAGTGGTGGTGGACATGGTGG - Intronic
1091748494 12:3008262-3008284 GCAGGTGGTGTGGGACTCTGGGG + Intronic
1091782883 12:3225009-3225031 GCTGGTGGTGGGCACCTTTGCGG + Intronic
1092090133 12:5797565-5797587 GCTGGTGGTGGGGAGCACTAGGG - Intronic
1092204178 12:6605913-6605935 GGTGGTGGAGGGGGGCGTTGAGG - Intronic
1092247604 12:6872379-6872401 GCTGGTGGTTCTGGACATGGAGG - Exonic
1092413645 12:8272910-8272932 ACTGGTGGAGGGGGGCAATGGGG - Intergenic
1092704291 12:11267332-11267354 CCTGGAGGAGGGGGACGTTGAGG + Exonic
1092708292 12:11308381-11308403 CCAGGAGGTGGGGGACCTTGAGG + Exonic
1092708425 12:11308822-11308844 GGAGGAGGTGGGGGACGTTGGGG + Exonic
1092712424 12:11353207-11353229 GCTGGAGGTGGGGGACCTTGAGG + Exonic
1092712454 12:11353330-11353352 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092712475 12:11353393-11353415 GGAGGAGGTGGGGGACCTTGGGG + Intronic
1092712509 12:11353513-11353535 CCTGGAGGTGGGGGACCCTGAGG + Intronic
1092712531 12:11353576-11353598 GGAGGAGGTGGGGGACCTTGGGG + Intronic
1092712565 12:11353696-11353718 CCTGGAGGTGGGGGACCTTGAGG + Intronic
1092712586 12:11353759-11353781 GGAGGAGGTGGGGGACCTTGGGG + Intronic
1092712623 12:11353879-11353901 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716160 12:11392927-11392949 GCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716192 12:11393050-11393072 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716211 12:11393113-11393135 GGAGGAGGTGGGGGACCTTGAGG + Exonic
1092716244 12:11393236-11393258 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716265 12:11393299-11393321 GGAGGAGGTGGGGGACCTTGGGG + Exonic
1092716299 12:11393422-11393444 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716320 12:11393485-11393507 GGAGGAGGTGGGGGACCTTGGGG + Exonic
1092716352 12:11393608-11393630 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716404 12:11393791-11393813 CCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716423 12:11393854-11393876 GGAGGAGGTGGGGGACCTTGAGG + Exonic
1092829942 12:12433956-12433978 GTTGGTGGTTGGGGACAGTGAGG + Intronic
1093310306 12:17573814-17573836 GCTGGCGTTGAGGGATATTGGGG + Intergenic
1094439027 12:30454490-30454512 GCTGGTGCTGGGAGAGATTCTGG - Intergenic
1095807376 12:46334884-46334906 GGGGGTGGTGGGGGGAATTGCGG - Intergenic
1096070292 12:48771672-48771694 GCTGGTGGTGGCAGAGAGTGGGG - Intronic
1096476785 12:51913537-51913559 GCTGAGGGAGGGGGACACTGAGG - Exonic
1097584599 12:61500154-61500176 GCTGATGATGGGGGAAATTGTGG - Intergenic
1097835273 12:64266558-64266580 CCTGCTGGTGGTGGACATAGTGG + Exonic
1098322398 12:69258934-69258956 GCTGGCGGTGGGGCACCTGGAGG - Exonic
1101074456 12:101114075-101114097 GCTGGTGGTGGGTCACAGTGAGG + Intronic
1101761144 12:107660085-107660107 GATGGGGGTGGGGGTCATGGAGG + Intergenic
1101840816 12:108326320-108326342 GCTCAGGGTGGGGGACATTCAGG - Intronic
1101909179 12:108849904-108849926 GCTGGGGGAGGGGAACATGGGGG + Intronic
1101909236 12:108850042-108850064 GCTGGGGGAGGGGAGCATTGGGG + Intronic
1102465828 12:113130455-113130477 GCAGGGGGTGGGGGATGTTGCGG - Intronic
1103854562 12:123957377-123957399 GCTGGTTGTGGGGGAGTGTGAGG + Intronic
1103938447 12:124489021-124489043 CCTAGTGGTGGGGGCCAGTGTGG - Intronic
1104423424 12:128655675-128655697 GCTGGTGGTGGGTGCCCCTGTGG - Intronic
1104641590 12:130470645-130470667 CCCGGGGGTGGGGGACGTTGGGG - Intronic
1104767565 12:131340374-131340396 GCTGATTGTGGGGGAGCTTGTGG + Intergenic
1105890402 13:24678638-24678660 GTTGGTGGTGAGGGACAATTGGG - Intergenic
1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG + Exonic
1107460890 13:40601071-40601093 ACGGGTGGTGGGGGGCATTGAGG - Intronic
1108287154 13:48919794-48919816 GGTGGGGTTGGGGGACAGTGGGG + Intergenic
1108334789 13:49428518-49428540 GCAGGTGGTGGGGGCCATCTTGG + Intronic
1108510807 13:51153990-51154012 GCTGGGGGTAGGGGAAAATGGGG - Intergenic
1109392468 13:61710281-61710303 GGTGGTGGTGGGGGAAATGGGGG - Intergenic
1110639525 13:77806206-77806228 GCTGGTTGTGGAGAACAGTGAGG - Intergenic
1111015352 13:82372884-82372906 GGTGGTGCTGGGGGACGCTGAGG + Intergenic
1111547658 13:89763830-89763852 GCTGGTGGGTGGGGAAAATGGGG + Intergenic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1112342755 13:98566078-98566100 GCTGGCGGTGTGGGTCCTTGTGG - Intronic
1113921867 13:113917866-113917888 GCTGGAGGATGGGGACATGGTGG - Intergenic
1114089707 14:19273565-19273587 GGTGGTGGTGGTGGTCATAGGGG + Intergenic
1114507430 14:23228152-23228174 GGTGGTGGAGGTGGAGATTGCGG + Intronic
1114882671 14:26806152-26806174 GGTGGTGGTGGGGGAATTGGGGG + Intergenic
1115066382 14:29266504-29266526 ACTGGGGGTGTGGGGCATTGAGG - Intergenic
1118135928 14:63027186-63027208 GCTGAAGGGTGGGGACATTGGGG + Intronic
1118895592 14:69943003-69943025 GCTGGTGGTGGGGGGCACAGTGG + Intronic
1120874343 14:89362492-89362514 GGTGGTGGTGGTGGAGATGGTGG - Intronic
1120874378 14:89362630-89362652 GGTGGTGGTGGTGGAGATGGTGG - Intronic
1120874391 14:89362675-89362697 GGTGGTGGTGGTGGAGATGGTGG - Intronic
1120874410 14:89362738-89362760 GGTGGTGGTGGTGGAGATGGTGG - Intronic
1121015527 14:90546607-90546629 GCTGCTGGTTGGGGGCAGTGTGG - Intronic
1121612725 14:95292666-95292688 GCTGGTGGTAGGGGAGGGTGGGG + Intronic
1121685322 14:95831362-95831384 CCTGTTTGTGGGGGACACTGAGG - Intergenic
1121841298 14:97136285-97136307 GCTGGTGGTGGTGGTGATGGTGG - Intergenic
1122314511 14:100817853-100817875 GCTGGTGGTGGAGGCCAGAGAGG + Intergenic
1122677674 14:103430369-103430391 GCTGGGGGTGGGGGAAGATGGGG - Intronic
1122840727 14:104461535-104461557 GCTGTGGGCGGGGGACATGGTGG + Intergenic
1122854731 14:104554634-104554656 GCGGGTGCTGGGGGCCGTTGTGG - Intronic
1202929280 14_KI270725v1_random:23916-23938 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1123423018 15:20147301-20147323 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1123532244 15:21153841-21153863 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1124467029 15:29949176-29949198 GCTGGTGGTGGAGGTGATGGAGG - Intronic
1125004956 15:34806925-34806947 GGTGGTGGTGGGGGGCATGGAGG - Intergenic
1126096720 15:45095511-45095533 GTTGGTGGGAGGGGGCATTGGGG - Exonic
1127332346 15:57951470-57951492 CCTGGTGGTGGGGGAGTCTGTGG + Intergenic
1127801063 15:62477882-62477904 GCAGGTGGTGGGGGGGATGGAGG + Intronic
1128201960 15:65816506-65816528 TCTGGTGGTGGTGGATATGGTGG - Intronic
1128802739 15:70507263-70507285 GATGGTGCTGGAGGACATTTGGG - Intergenic
1129138696 15:73577283-73577305 CCTGCTGATAGGGGACATTGTGG - Intronic
1129167319 15:73786082-73786104 GGAGGTGCTGGGGGACACTGTGG + Intergenic
1129243234 15:74264196-74264218 GGTGGGGGTGGGGGAGATGGAGG + Intronic
1129686062 15:77686730-77686752 GCTGGAGGCAGGGGCCATTGAGG - Intronic
1129862316 15:78872598-78872620 GCTGGCGATGGGGGAGAGTGGGG - Intronic
1130961191 15:88659639-88659661 GATGGGGCTGGGGGACAGTGGGG - Intergenic
1131945115 15:97610952-97610974 CCTGGTGGTGGTGGCCACTGGGG + Intergenic
1132067260 15:98742416-98742438 GCTTGTGGTGGGGGGCAAGGTGG + Intronic
1132195674 15:99913095-99913117 GCTGTTGCTGGGGGAGGTTGTGG + Intergenic
1132291995 15:100710382-100710404 GGTGGTGGTGGAGGTCATGGTGG + Intergenic
1132399541 15:101496918-101496940 GCAGGTGGTGGGGCCCACTGAGG + Intronic
1132978832 16:2724472-2724494 GCTGATGGTGAGGGACATTCTGG + Intergenic
1133204014 16:4222092-4222114 GGTGGTGGTGTGGGCTATTGGGG - Intronic
1133352413 16:5110330-5110352 GCGGGGGGTGGGGAACATTTAGG + Intergenic
1135065887 16:19309483-19309505 GCTGGGAGTGGGGGAAAATGCGG + Intronic
1135703037 16:24649776-24649798 GCTGGGGGATGGGGAAATTGGGG - Intergenic
1136069538 16:27779467-27779489 GCAGGTGTTGGGGAACACTGAGG + Exonic
1136292567 16:29284666-29284688 GATGGTGGTGGTGGTCCTTGTGG + Intergenic
1137530279 16:49275119-49275141 GGTGGTGGTGGGGGATAGTGCGG - Intergenic
1137693022 16:50442315-50442337 GCTGGTGCTGGGGAACATGGTGG - Intergenic
1137977337 16:53042586-53042608 TCTGGTGGTGGGGGACGGGGAGG - Intergenic
1137997650 16:53236608-53236630 GGTGGTGGTGGGGGGGAATGGGG - Intronic
1139465784 16:67153354-67153376 GATGGGGGTGGGGGAAATGGTGG - Intergenic
1139656216 16:68388600-68388622 GCAGCTGGTGGGGGACAGTTTGG - Intronic
1140947826 16:79786747-79786769 GCTGGTGGTGGTGGTGATGGTGG - Intergenic
1141881366 16:86861976-86861998 GCTGGTGGTGGTGGTGATGGTGG + Intergenic
1141881393 16:86862162-86862184 GCTGGTGGTGGCGGTGATGGTGG + Intergenic
1142004108 16:87680971-87680993 GTGTGTGGTGGGGGGCATTGTGG + Intronic
1142087776 16:88193272-88193294 GATGGTGGTGGTGGAGATGGTGG + Intergenic
1142098457 16:88258681-88258703 GATGGTGGTGGTGGTCCTTGTGG + Intergenic
1142363464 16:89637990-89638012 GGTGGTGGTGGGGGAGACTCAGG - Intronic
1142579014 17:929232-929254 CCAGGTGGTGGGGGACAGAGTGG - Intronic
1142596766 17:1033560-1033582 GCTGGTGGAGGGGGGCCTTGGGG + Intronic
1143978328 17:10846565-10846587 GGTGGTGGTGGTGGAAATAGAGG + Intergenic
1143978423 17:10846970-10846992 GGTGGTGGTGGTGGAAATAGAGG + Intergenic
1144424022 17:15124209-15124231 GCTGGTGGTGGTGGACAGTGGGG - Intergenic
1144457249 17:15429415-15429437 GATGGTGGTGGTGGTCATGGTGG + Intergenic
1144950830 17:18992576-18992598 GCTGGGGCTGAGGGAGATTGAGG - Intronic
1145784077 17:27582829-27582851 GCTGGGGGTGGGGGAGTCTGAGG - Exonic
1146113183 17:30110584-30110606 GCTGGGGGTAGGGGAAAGTGGGG - Intergenic
1146370481 17:32262993-32263015 GCTGGGCGTAGGTGACATTGAGG + Intergenic
1146523037 17:33541362-33541384 TCTGTTCGGGGGGGACATTGTGG - Intronic
1147453568 17:40520856-40520878 GCTGGTGGAGGTGGGCACTGAGG + Intergenic
1147576016 17:41599398-41599420 GATGGTGGTGGTGGTCATGGTGG + Intergenic
1148446527 17:47741219-47741241 GCTGGTGCTGGTGGAGATCGTGG + Intronic
1149149410 17:53542365-53542387 GCTGGGGTAGGGGGAAATTGTGG - Intergenic
1149456542 17:56792890-56792912 GATGGTGGTGGGGGTGATGGTGG + Intronic
1150119153 17:62585151-62585173 GCTGGCAGTGGTGGCCATTGGGG + Intronic
1150649253 17:66999286-66999308 GGTGGTGGTGGTGGTCATTGTGG + Intronic
1150701480 17:67450856-67450878 GGTGGGGGAAGGGGACATTGGGG - Intronic
1151212142 17:72552684-72552706 GCTGGTGGGAGGGGGAATTGAGG - Intergenic
1151546761 17:74797995-74798017 GCTGGTGGTGAGAGGCAGTGTGG - Intronic
1151850475 17:76686895-76686917 GCTGGGGGTGGGGGATGTTCAGG + Intronic
1151878762 17:76882038-76882060 GTTGGTGCTGGGGGACTTTGGGG + Intronic
1151963294 17:77418763-77418785 GCTGGTGACGGGGGACCTTTTGG + Intronic
1151976141 17:77484444-77484466 GATGGTGGTGGTGGTGATTGTGG + Intronic
1152380953 17:79941999-79942021 GCTGGTGGGGTGGGGCTTTGGGG + Intronic
1152385505 17:79971874-79971896 GCTGGCTGTGGGGGTCTTTGTGG + Intronic
1152801951 17:82334603-82334625 GCAGATGATGGGGGACACTGGGG + Intergenic
1152811139 17:82383352-82383374 GCGGGGGGTGGGGGGCATTGCGG - Intergenic
1152908381 17:82982932-82982954 GCTGGGGGTGGAGGAGATGGGGG + Intronic
1152931841 17:83113959-83113981 GCTGGTGGTGGGGGGCACAGAGG + Intergenic
1154163089 18:11994508-11994530 GCGGGTGCTGGGGGCCCTTGGGG - Intronic
1154464495 18:14630751-14630773 GATGGTGGTGAGTGCCATTGTGG - Intergenic
1155197284 18:23486788-23486810 CCTGGGGGTGTGGGACAGTGGGG + Intergenic
1155226848 18:23736854-23736876 GCTGGGGATGAGGGACCTTGGGG + Intronic
1157605717 18:48924713-48924735 GCTGCTGGTGGGGGAGCTGGAGG - Intronic
1159194860 18:65100472-65100494 CCTGGGGGTGGGGGGCATTGTGG - Intergenic
1159435600 18:68413281-68413303 GATGGTGGTGACGGACATGGTGG + Intergenic
1160257286 18:77258635-77258657 GATGGTGGTGGTGGTCATAGTGG + Intronic
1160257292 18:77258656-77258678 GGTGGTGGTGGTGGTCATGGTGG + Intronic
1160257318 18:77258796-77258818 GATGGTGGTGGTGGTCATAGTGG + Intronic
1160257471 18:77259519-77259541 GATGGTGGTGGTGGTCATAGGGG + Intronic
1160703882 19:520153-520175 GTTGGTGGTGGTGGGCACTGGGG - Intergenic
1161126429 19:2560517-2560539 GGCGGTGGCTGGGGACATTGTGG + Intronic
1161138233 19:2633306-2633328 GCTGGGGGCAGGGGACATGGGGG - Intronic
1161335081 19:3708646-3708668 GCTCGTGGTGGGGGAGGTTGGGG - Intronic
1161412509 19:4124188-4124210 GCTGGGGGTGGGGTCCATCGCGG - Intergenic
1161731361 19:5962835-5962857 TCTGGTGGTCGGGGGCAGTGGGG - Intronic
1161850655 19:6736576-6736598 CCTGCTGGTGAGGGACCTTGAGG - Exonic
1161968676 19:7563115-7563137 GAGGGTGGAGGGGGACATTTAGG + Intergenic
1162132662 19:8536666-8536688 GCTGGAGGTGGGGGACCTGGGGG + Intronic
1162156399 19:8680985-8681007 GCAGGTTGTGGAGGACTTTGTGG + Intergenic
1162187347 19:8916169-8916191 GATGGTGGTGGGGGTTATTATGG - Intronic
1162381462 19:10334160-10334182 GGTCGTGGTGATGGACATTGAGG - Exonic
1162469566 19:10864392-10864414 GCAGGAGGTGGGGAAGATTGGGG + Intronic
1162834657 19:13308358-13308380 GGTGGGGATGGGGGACATGGTGG - Intronic
1163054187 19:14706069-14706091 GCTGGAGGTGGGTTACATTTTGG - Intronic
1163418895 19:17203289-17203311 AGGGGTGGTGGGGGACATGGAGG - Intronic
1163476421 19:17528656-17528678 GCTGGGCGCTGGGGACATTGTGG + Intronic
1163628017 19:18402054-18402076 GCAGGTGGTGGGGGACAGGCAGG + Intergenic
1163998197 19:21072272-21072294 GCTGGTGGTGGGGGAGATGTTGG - Intergenic
1164424471 19:28128697-28128719 GGTGGTGGTGGTGGAAAATGAGG - Intergenic
1164500971 19:28820125-28820147 ACTGGGGGTGAGGGAAATTGGGG - Intergenic
1164905325 19:31962867-31962889 GCTGTTGGTGGGGGAAATGGTGG - Intergenic
1165074816 19:33274941-33274963 GCTAGTGCCTGGGGACATTGGGG - Intergenic
1165186038 19:34022660-34022682 ACTGGTGGTGGGTGAAATGGTGG - Intergenic
1165227385 19:34364736-34364758 GCTGGTGGTAAGGGCTATTGAGG - Exonic
1165395294 19:35560543-35560565 ACTGGTGGTGGGCGACCTGGTGG - Exonic
1165758031 19:38305300-38305322 GCTGCTGCTGGGGGCCACTGTGG - Exonic
1166315285 19:41985926-41985948 GGTGGTGGTCGGGGACCTGGTGG - Exonic
1166749021 19:45155983-45156005 GCTGATAGTGGGGGCCATGGAGG - Intronic
1167630781 19:50625294-50625316 GCTGGGGGTTGGGGTCAGTGAGG + Exonic
1202692856 1_KI270712v1_random:104070-104092 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
925188946 2:1867622-1867644 TCTGGGGGTGGGGGACCTCGGGG + Intronic
925607559 2:5673801-5673823 GCCGGGGGTGGGGGACAGAGGGG + Intergenic
925618975 2:5771971-5771993 GCTGCTGGTTGAGGAGATTGAGG + Intergenic
927131068 2:20061239-20061261 GTTGGGGGCGGGGGGCATTGCGG - Intergenic
927282754 2:21324885-21324907 GCTAGAGGTGGGGGAAAATGGGG - Intergenic
928635647 2:33243152-33243174 GCTGGAGGTGGGGCAGACTGTGG - Intronic
930733022 2:54745993-54746015 GCTGGTGGTGGAGGAAGTGGAGG + Intronic
930901840 2:56516471-56516493 GCTGGTTCTGGTGGACATTAGGG - Intergenic
931175595 2:59851249-59851271 GGTGGGGGTGGGGGACAGAGAGG + Intergenic
931373821 2:61689203-61689225 GGTGGTGGTGGGTGGCACTGGGG + Intergenic
932142875 2:69294989-69295011 GCTGGGGGTGGCGGACCTCGAGG + Intergenic
933836945 2:86253485-86253507 GGTGGTGGTGGGGGACAGGCAGG - Intronic
933953545 2:87349897-87349919 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934063889 2:88321718-88321740 GCTGCTGGCGGGGGATTTTGAGG - Intergenic
934237750 2:90246145-90246167 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934275451 2:91570586-91570608 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
934460180 2:94209477-94209499 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
934907003 2:98213747-98213769 GCTGGAGTTAGGGGACAGTGTGG + Intronic
934951425 2:98578313-98578335 GGTGGTGGGAGGGGACATTCTGG + Intronic
935103188 2:100016158-100016180 GCTGGTGGTGGTGGTAGTTGTGG + Intronic
935588581 2:104824344-104824366 GCTGGTAGTGGTGGTGATTGTGG + Intergenic
936863989 2:117056186-117056208 GCAGAGGGTGGGGGACATGGCGG + Intergenic
937262965 2:120598130-120598152 GCTGGTGCCGGGGCCCATTGTGG + Intergenic
937307596 2:120881716-120881738 GCAGGTGGGGGAGGACAGTGCGG + Intronic
938063668 2:128269899-128269921 GGTGGGGGTGGGGGGCATGGAGG + Intronic
938565888 2:132518472-132518494 TCTGGTGGTGAGGGACCTTGAGG + Intronic
940716193 2:157227323-157227345 GTGGGGGGTGGGGGGCATTGGGG - Intergenic
941269761 2:163410320-163410342 GGTGGTGGTGGTGGAGATAGTGG + Intergenic
942198432 2:173546324-173546346 GGTGGTGGTGGGCGTCATTGTGG + Intergenic
943043474 2:182830228-182830250 TCTGGTGGTGGGAAACATAGGGG + Intergenic
943450295 2:188036414-188036436 GGTTGTGGAGGGGGGCATTGAGG - Intergenic
943674875 2:190706946-190706968 GGTGGGGGTGGGAGACAGTGTGG - Intergenic
944192271 2:197015790-197015812 TATGGTGGTGGGGGATATGGTGG + Intronic
944502869 2:200379681-200379703 GCGGGTGGTGGGGGGGATGGGGG + Intronic
945055721 2:205867219-205867241 GCTGGGGGCTGGGGACATAGGGG - Intergenic
946411731 2:219518576-219518598 GCTGGGGGTGGGGGACATACAGG - Intronic
946432621 2:219633689-219633711 GGTGGTAGTTGGGGACATCGAGG + Intronic
947497894 2:230651979-230652001 GCTGGGGGAGGGGGAGAATGAGG - Intergenic
947764007 2:232624284-232624306 GCTGGGGCTGGGGGACTTTAGGG - Intronic
948468294 2:238162539-238162561 GCTGGAGGTGGGGGCCCTCGGGG - Intronic
948678163 2:239611276-239611298 CCTGATGGTGGGGAACAGTGCGG + Intergenic
948800328 2:240430528-240430550 GCTGGGGGTGGGGGGGGTTGGGG - Intergenic
1168737134 20:150342-150364 GCGGGTGGTGGAGGAAATGGGGG - Intergenic
1169155074 20:3322846-3322868 GCTGGTGGTGTGGGACCCTGGGG - Intronic
1169162293 20:3391350-3391372 GCTGGGAGTGTGGGTCATTGTGG - Intronic
1169654118 20:7903596-7903618 GGTGGTGGTGGTGGTCATAGTGG + Intronic
1169654147 20:7903732-7903754 GGTGGTGGTGGTGGTCATGGTGG + Intronic
1170446646 20:16434901-16434923 GCTGGGGGTTGGGGACAATCAGG + Intronic
1170916214 20:20628587-20628609 GGTGGGGGTGGGGGCCATTCTGG + Intronic
1172303072 20:33863338-33863360 GCTGGGGGTGGGGGACACACAGG - Intergenic
1173656422 20:44703158-44703180 GCTGGTGGCGTGGGGCACTGGGG + Intergenic
1174376190 20:50128245-50128267 GCAGGTGGTGAGGGCCATTTGGG - Intronic
1175265876 20:57703250-57703272 GATGGGGGTGGGGGACATCAGGG + Intronic
1175272234 20:57742469-57742491 GCTGGGTGTGGGGAACATTCTGG + Intergenic
1175420612 20:58830231-58830253 GATGGTGGTGGTGGTGATTGTGG - Intergenic
1175420689 20:58830585-58830607 GATGGTGGTGGTGGTGATTGTGG - Intergenic
1175490585 20:59378300-59378322 GCTGGGGGTGGAGGCCATTGAGG + Intergenic
1175955258 20:62605737-62605759 GCTGGGGGTGGAGGAAGTTGGGG + Intergenic
1176247836 20:64105686-64105708 GGTGGTGGTGGGGGTGATGGTGG + Intergenic
1176810042 21:13527638-13527660 GATGGTGGTGAGTGCCATTGTGG + Intergenic
1178369190 21:32012942-32012964 CTTGGTGGTGGGGGGCAGTGGGG - Intronic
1178505655 21:33160852-33160874 GATGGTGGTGGTGGTCATGGAGG + Intergenic
1178851958 21:36219931-36219953 GGGGGTGTTGGGGGAGATTGGGG + Intronic
1179887121 21:44318955-44318977 GCAGGTGATGGGGAACACTGGGG + Intronic
1180000236 21:44992290-44992312 GCAGGGGGTGGGGGAGACTGAGG + Intergenic
1180274150 22:10629627-10629649 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1180490997 22:15848782-15848804 GGTGGTGGTGGTGGTCATAGGGG - Intergenic
1180793842 22:18592281-18592303 GCTGGTGGTGGGGGAAGGCGAGG - Intergenic
1180953794 22:19732352-19732374 GCTGGGTGTGGGGGCCACTGGGG - Intergenic
1181031631 22:20150922-20150944 GCTGGGGTTGGGGGACACTGGGG + Intergenic
1181227898 22:21403039-21403061 GCTGGTGGTGGGGGAAGGCGAGG + Intergenic
1181250755 22:21531800-21531822 GCTGGTGGTGGGGGAAGGCGAGG - Intergenic
1181356078 22:22297275-22297297 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1181511770 22:23392595-23392617 GCTGCGGCTGGGGGACACTGGGG - Intergenic
1182170579 22:28224666-28224688 GCTGGTGGAGGGGGTCATGGGGG + Intronic
1182443762 22:30378713-30378735 GGTGGTAGTGGGAGACCTTGGGG + Intronic
1182674230 22:32025178-32025200 GCTGCTGGTGAGGGTCCTTGAGG + Intergenic
1183131616 22:35842691-35842713 GATGGGGGCGGGGGACATTGTGG - Intronic
1183855612 22:40631951-40631973 GCAGGAGGTGAGGGTCATTGGGG - Intronic
1183903242 22:41021837-41021859 GCTGGGGGCGGGGGAGCTTGTGG - Intergenic
1183909610 22:41068601-41068623 GGTGGTGGTGGGGGACAGAAAGG - Intergenic
1184072518 22:42154788-42154810 GCTGGTGGTGGGGGATCCTCAGG + Intergenic
1184073457 22:42161397-42161419 GCTGTTGGTGGTGGACCCTGTGG - Intronic
1184158492 22:42684381-42684403 GCTGGAGGTGGGAGTCATTCTGG + Intergenic
1184164035 22:42717015-42717037 GCTTGTGGTGGGTGACAGTGCGG + Intronic
1184289689 22:43491924-43491946 GCTGGTGGTGGTGGTCATGATGG + Intronic
1184290352 22:43495523-43495545 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290356 22:43495538-43495560 GATGGTGGTGGTGGAGATGGTGG + Intronic
1184290391 22:43495667-43495689 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290418 22:43495760-43495782 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290445 22:43495853-43495875 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290473 22:43495955-43495977 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290477 22:43495970-43495992 GATGGTGGTGGTGGAGATGGTGG + Intronic
1184290482 22:43495988-43496010 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290620 22:43496468-43496490 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184290635 22:43496525-43496547 GATGGTGGTGGTGGAGATGGTGG + Intronic
1184290638 22:43496540-43496562 GATGGTGGTGGTGGAGATAGTGG + Intronic
1184290648 22:43496576-43496598 GGTGGTGGTGGTGGAGATGGTGG + Intronic
1184784964 22:46667152-46667174 GGCAGGGGTGGGGGACATTGAGG + Intronic
1185193165 22:49451692-49451714 GCAGGTGGTAGGGGCCAGTGTGG - Intronic
1185348139 22:50319572-50319594 GCGGGTGGTGAGGGAGATGGAGG - Intronic
949280468 3:2340993-2341015 GCTGGAGGAGAGGGACCTTGTGG - Intronic
949646763 3:6104693-6104715 GGTGGTGGTGGTGGAAAGTGGGG + Intergenic
949961766 3:9318249-9318271 GCTGGAGGTGAGGGACATGTCGG - Intronic
950693882 3:14682993-14683015 GCTGGTGGTGGTGGAGGTAGTGG - Exonic
951604694 3:24420177-24420199 GCTGGTCCTGGGAGACACTGAGG - Intronic
951800737 3:26593227-26593249 GCAGGAGGTGGGGGAAATTGGGG - Intergenic
952384632 3:32831139-32831161 GATGGGGGTGGGGGACCGTGGGG + Intronic
953110008 3:39926073-39926095 TCTGATGGTGAGTGACATTGAGG + Intronic
953428727 3:42818987-42819009 GGTGTTGGTGGGGGAAATGGGGG + Intronic
954406487 3:50348146-50348168 GCTGGGGGTGGCGGCCAATGAGG + Exonic
954709468 3:52498201-52498223 GCTGCTGCTGGGGGAAGTTGAGG - Intronic
955379394 3:58424775-58424797 GCTGGTGGTGGTGGAGGTGGAGG - Exonic
956217571 3:66864557-66864579 CCTGGGGATGGGAGACATTGCGG - Intergenic
956685676 3:71825213-71825235 GCTGGGGTCGCGGGACATTGTGG + Intergenic
957056402 3:75446236-75446258 GCGGGGGGTGGGGAACATTTAGG + Intergenic
958772106 3:98437355-98437377 GCAGCTGGTGAGGGACATTCTGG + Intergenic
959336171 3:105067302-105067324 GCTAGTGGTGGTGGCCATAGGGG + Intergenic
959796513 3:110436059-110436081 ACAGGTGGAGGGGAACATTGAGG - Intergenic
961000618 3:123371771-123371793 GGTGGGGGTGGGGGACAATCAGG - Intronic
961294760 3:125875940-125875962 ACTGGTGGAGGGGGGCAATGGGG + Intergenic
961297982 3:125902474-125902496 GCGGGGGGTGGGGAACATTTAGG - Intergenic
961393727 3:126571495-126571517 GCTGGTGGTGGGGGCGGTGGGGG + Intergenic
961656624 3:128445944-128445966 GCTGGTGGTGGTGGTGATGGCGG + Intergenic
961891199 3:130131542-130131564 ACTGGTGGAGGGGGGCAATGGGG - Intergenic
962204601 3:133424520-133424542 GCTGGAGGTGGGAGAGATTAGGG - Intronic
962622121 3:137190462-137190484 GCTGGTGGTGAGGGTCCTAGTGG + Intergenic
962785827 3:138767780-138767802 GCTGGCACTGGGGGACATGGTGG + Intronic
962866631 3:139452728-139452750 GTTGGTTGTGGGGGACATGGGGG - Intergenic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
962988719 3:140559544-140559566 GCTGGTGGCGGGGGTCAGGGGGG + Intronic
963945366 3:151140396-151140418 GCTGGTGGAGGGGGAGAAAGGGG - Intronic
966103268 3:176302515-176302537 GCTGGAGGGAGGGGACAGTGGGG - Intergenic
967117574 3:186355564-186355586 GATGGTGGTGGGGGTAATGGTGG - Intronic
967429291 3:189363070-189363092 GGCGGGGTTGGGGGACATTGGGG - Intergenic
967556213 3:190862311-190862333 GCAGGTGGAGGGGGAAGTTGGGG + Intronic
968605163 4:1531977-1531999 GCTGCTGATGGGGGACAGAGCGG - Intergenic
968624613 4:1621530-1621552 GCTTGGGGTGGGGGACAGTGGGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969166832 4:5323287-5323309 GCTGGTGGAGGGGGACTTGCAGG - Intronic
969483945 4:7461340-7461362 GCTGGTGAGGCGGGACTTTGGGG - Intronic
969523235 4:7691125-7691147 GATGGTGCTGGGGGAAATGGAGG - Intronic
969811340 4:9650829-9650851 CCTGGTGGAGGGGGGCAATGGGG + Intergenic
969814682 4:9678401-9678423 GCGGGGGGTGGGGAACATTTAGG - Intergenic
970281104 4:14456573-14456595 GCTGGAGGTGGGGGACCTGGTGG - Intergenic
970992088 4:22224170-22224192 GCTGTTGGTAGCGGAGATTGGGG - Intergenic
972404523 4:38733581-38733603 GATGGTGGTGGTGGTCATCGTGG + Intergenic
972404635 4:38734151-38734173 GCTGGTGGTGGTGGTGATGGTGG + Intergenic
972961993 4:44464269-44464291 TGTGGTGGTGGAGCACATTGTGG + Intergenic
973288598 4:48447187-48447209 GCTGGGGGGAGGGGAAATTGGGG - Intergenic
974819285 4:67045742-67045764 GCAGGGGGTGGGGGTCATGGGGG - Intergenic
975165002 4:71168588-71168610 GGGGGTGGTGGGGGAAAGTGGGG - Intergenic
977088484 4:92636541-92636563 CATGGTGGTAGGGGACAGTGTGG + Intronic
977746755 4:100558534-100558556 GCTGTTGGTGGGGGGCACGGTGG + Intronic
978164166 4:105586895-105586917 GGTGGGGGTGGGGGAGACTGAGG - Intronic
978564453 4:110066911-110066933 GCAGGGGGTGGGGGGCAATGGGG - Intronic
981415657 4:144490233-144490255 GCAGGTGGTGTGGTACCTTGAGG - Intergenic
981920505 4:150079590-150079612 GCTGGGGGTGGGGGCCGGTGGGG + Intronic
982226275 4:153170417-153170439 GCTGATGGTGCAGGGCATTGTGG + Intronic
982727270 4:158918900-158918922 TCTGGTGGTGGTGTTCATTGTGG - Intronic
985052348 4:186004057-186004079 GCAGGTGGTGGAGTACATTTTGG + Intergenic
985672221 5:1212948-1212970 GCTTGTGGTGGGGGGCATGTGGG - Intronic
986422826 5:7601203-7601225 TCAGGTGGTGAGGGACAATGAGG - Intronic
987318210 5:16743934-16743956 GGTGGTGGAGGGGGGCAGTGTGG + Intronic
988696933 5:33631383-33631405 GCTGGTGGTGATGGAGGTTGTGG - Intronic
990645462 5:57838630-57838652 GCTGGTGGAGAGGAAAATTGTGG + Intergenic
990992823 5:61701871-61701893 TCTGGGGGTGGGGGAAACTGGGG - Intronic
991301854 5:65136048-65136070 GCTGGTGGTTTGGGGCATGGGGG + Intergenic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
992925812 5:81585805-81585827 GCTGGTGGGGAGGGATACTGGGG - Intronic
993487850 5:88508426-88508448 GCAGGTGGTAGGGGAGTTTGGGG + Intergenic
993886818 5:93424582-93424604 GCTGGTGGTAGGGAGGATTGAGG - Intergenic
993892584 5:93491258-93491280 GGTGGTGGTGGTGGTCATGGTGG + Intergenic
995292535 5:110473970-110473992 GCTGGGGGTGGGGGAGAGTAGGG + Intronic
997381252 5:133440038-133440060 CCTGGGGGTGGGGGACATGCTGG + Intronic
997459577 5:134042866-134042888 TCTGGAGGTGGGGGACCTGGGGG - Intergenic
997629451 5:135355856-135355878 GCTGGTGGGAGGGGACCCTGGGG - Intronic
997759309 5:136429588-136429610 CCTGGTGGTGGTGGATATGGTGG + Intergenic
998026415 5:138820032-138820054 GCTGGCGGTGGGGGGCAGGGCGG - Intronic
998179722 5:139928067-139928089 GCTGTTGGTTGGGGACTGTGGGG - Intronic
998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG + Intergenic
999305309 5:150515715-150515737 CAGGGTGGTGGGGGTCATTGAGG + Intronic
999424512 5:151475659-151475681 GCAGGTGGTGGGGGACACTGGGG + Intronic
999589975 5:153134174-153134196 CCTGGTGGTGGGTTAAATTGTGG - Intergenic
1000199149 5:158990219-158990241 GCTGGTGATGGAGCACACTGTGG + Intronic
1001797216 5:174512677-174512699 GCTGGTGGTGGGGGGCAAAGTGG + Intergenic
1002079764 5:176730388-176730410 GATGGGGGTGGGGGACAGGGGGG + Intergenic
1002403726 5:179011951-179011973 ACTGGTGGTGGTGGAGAATGGGG + Intergenic
1002590724 5:180290342-180290364 GGTGGTGCTGGGGGGCCTTGAGG - Intronic
1003510847 6:6779017-6779039 GCTGGTGTGGGTGGACATTCAGG + Intergenic
1003731349 6:8828062-8828084 GGTGGTGGTGGAGGCAATTGTGG + Intergenic
1004419766 6:15458623-15458645 ATTGGTGGTGGGTGAAATTGAGG + Intronic
1004778357 6:18874656-18874678 GCTGGGGGGTGGGGAAATTGGGG - Intergenic
1004854023 6:19731253-19731275 GGGGGTGGTGGGGGACTGTGGGG - Intergenic
1005450511 6:25967377-25967399 GGTGGTGGGGAGGGACATTTAGG + Intronic
1005893358 6:30158037-30158059 ACTGGTGGTTGGTGACATTTAGG + Intronic
1005959322 6:30684709-30684731 GCTGGGGGTGGGGGAGACAGAGG + Exonic
1006314251 6:33280698-33280720 GCTGGGGGTGGGGCACACTGGGG - Exonic
1006428717 6:33982337-33982359 GCTGGTGGTGGGGGGTGGTGGGG - Intergenic
1006785452 6:36663489-36663511 GCTATTTGTGGGGGACATTCTGG + Intergenic
1006984074 6:38166272-38166294 GCCGGTGGTGGGGGAGGTGGAGG - Intergenic
1006984085 6:38166305-38166327 GCCGGTGGTGGGGGAGGTGGAGG - Intergenic
1006984167 6:38166579-38166601 GCCGGTGGTGGGGGAGGTGGAGG - Intergenic
1007022589 6:38536826-38536848 GCTGGGGGTGGAGGAAAGTGGGG + Intronic
1007180411 6:39925678-39925700 GCCGGACGTGGTGGACATTGTGG - Exonic
1007269448 6:40624910-40624932 GCTGGGGCTGGGCCACATTGAGG + Intergenic
1008764136 6:54890655-54890677 GCAGGTGGTGGGGGAAGATGAGG - Intronic
1009380879 6:63028135-63028157 GTTGGTGGTGGGGGAGAATAGGG - Intergenic
1012673040 6:102079859-102079881 GGTGGTGGTGGTGGTGATTGTGG - Intergenic
1012921681 6:105226510-105226532 GCTGGGGTTGGGGGACAGCGAGG + Intergenic
1013305471 6:108843565-108843587 GTTGGTGGGGGTGGACATGGGGG + Intergenic
1013308379 6:108871138-108871160 GCTGGTGGTGGAGGACCTGGAGG + Intronic
1013312921 6:108914435-108914457 GCAGGTGGTGGTGGGCAGTGAGG - Intronic
1014603869 6:123448383-123448405 GCTGTTGGCGGGGGACATGGTGG + Intronic
1014809424 6:125869315-125869337 GCTGGTGGGGGGGAAGACTGGGG - Intronic
1014862449 6:126486177-126486199 GCTGGGGGTAGGGGAAATAGGGG - Intergenic
1015849135 6:137553418-137553440 GCTGGTGATGGAAGCCATTGTGG + Intergenic
1016352163 6:143179223-143179245 CCTGCTGGTGGGGGATGTTGAGG + Intronic
1017131909 6:151114900-151114922 GCTGGTGGTGTGGGCCGTGGGGG - Intergenic
1017429226 6:154354431-154354453 GGTGGTGGTGGAGGAGATGGTGG - Intronic
1017672108 6:156778190-156778212 GGTGGTGGTGGTGGGCATGGTGG - Exonic
1017978975 6:159382031-159382053 GGGGGTGGTGGGGGAAAATGTGG - Intergenic
1018053090 6:160028630-160028652 CCTGGTGGTGGGGGCCATGTTGG + Intronic
1018356951 6:163027918-163027940 GTGGTTGGTGGGGGACAGTGTGG - Intronic
1018738746 6:166711090-166711112 GGTGGTGGTGGAGGACACTGAGG + Intronic
1018851105 6:167590736-167590758 GGTGGTGGTGGTGGAGATGGAGG - Intergenic
1020434995 7:8152632-8152654 GGTGGTGGTGGAGGAGATGGTGG - Intronic
1020860766 7:13489396-13489418 GCTGTTGGTGGGGGGCATGGTGG + Intergenic
1021431301 7:20561192-20561214 GTTGGTGGTGGGGGATAAAGTGG - Intergenic
1021515977 7:21487785-21487807 GGTGGTGGTGGTGGTCATGGTGG + Intronic
1022374737 7:29802825-29802847 GCGGGGGGTGGGGGGCATTGGGG + Intergenic
1022455676 7:30556264-30556286 TCTTGTGGTGGGAGAAATTGAGG + Intergenic
1022474033 7:30698818-30698840 GCTTGTTGTGAGGAACATTGAGG - Intronic
1022639808 7:32171055-32171077 GGAGGTGGGGTGGGACATTGTGG - Intronic
1023853303 7:44162884-44162906 GCTGGTGGAGGTGGACACAGTGG + Intronic
1024115854 7:46192392-46192414 GCTGGGGGTGGGAGTCAGTGAGG - Intergenic
1026773666 7:73217835-73217857 GGTGGAGGTGGGGGACAGTAAGG + Intergenic
1026805072 7:73424201-73424223 GGTGGGGGTGGGGGACGCTGGGG + Intergenic
1027014525 7:74771229-74771251 GGTGGAGGTGGGGGACAGTAAGG + Intergenic
1027073508 7:75174728-75174750 GGTGGAGGTGGGGGACAGTAAGG - Intergenic
1027237350 7:76305947-76305969 GGTGGTGGGGGGTGATATTGGGG - Intergenic
1028774866 7:94664996-94665018 GCTGGTGGTGGGAGCGATGGTGG - Exonic
1029033069 7:97489190-97489212 GTTGGTGGTGGGGGAGAGTAGGG - Intergenic
1029386944 7:100249371-100249393 CCTGGTGGTGGGAGACACAGTGG - Intronic
1031189204 7:118525236-118525258 GCTGTTGGGGGAGGACAATGTGG - Intergenic
1031678766 7:124645055-124645077 GCTGGTGGATGGGGAAAATGGGG - Intergenic
1031868158 7:127062480-127062502 GCTGGTGTCAGGGGACATGGGGG + Intronic
1032759178 7:134922596-134922618 GCTGGGGTCGGGGGACACTGGGG + Intronic
1033064979 7:138145790-138145812 GCTGGTGGAGGGGGGCGTGGAGG + Intergenic
1033128837 7:138728298-138728320 CAGGGTGGTGGGGGAGATTGCGG - Intronic
1034416582 7:150968331-150968353 GCTGGGAGTTGGAGACATTGTGG + Intronic
1034438362 7:151074404-151074426 GCGGGTGATTGGGGACTTTGGGG + Exonic
1034705513 7:153139645-153139667 GCTGGGGGTGGTGGACATGTTGG - Intergenic
1035027805 7:155837124-155837146 GTTGGGGTTGGGGGACATGGTGG - Intergenic
1035405620 7:158595232-158595254 GCTGGTGGTGGTGGAGGTGGTGG + Intergenic
1036876262 8:12475676-12475698 ACTGGTGGAGGGGGGCAATGGGG - Intergenic
1037121316 8:15290552-15290574 GCTGGTGGAGGGGGAAAATGTGG - Intergenic
1038892910 8:31747025-31747047 GCTGGTGGTTGGGGAGGTAGGGG + Intronic
1040552913 8:48452552-48452574 GATGGTGTTGGTGGACATTTAGG - Intergenic
1041545162 8:59034428-59034450 GGTGGAGGTGGGGGACAGGGTGG - Intronic
1042768855 8:72356812-72356834 GCTGCTGGTGGAGTACATTCAGG + Intergenic
1043034581 8:75179559-75179581 CCTGGTGGTGTGGGAGACTGGGG - Intergenic
1043377715 8:79668955-79668977 GTGGGTGGTGGGGGACAGTGAGG - Intergenic
1043450542 8:80361836-80361858 GTTGGGGGTGGCGGACATGGTGG + Intergenic
1043589232 8:81808464-81808486 TGTGGTGGTGGGGGATATGGTGG + Intronic
1044751394 8:95419610-95419632 GCTGGTGCTGGTGGACATGGTGG + Intergenic
1044898118 8:96914735-96914757 GCTGGAGGTGGGGAACATTATGG - Intronic
1046951040 8:120019981-120020003 GCTGGTGATGGGGGATACCGGGG - Intronic
1047220907 8:122917376-122917398 GGTGGGGATGGAGGACATTGTGG - Intronic
1048180242 8:132187815-132187837 GGTGGTGGTGGTGGTGATTGTGG + Intronic
1048221469 8:132546140-132546162 GGTGGTGGTGGTGGTGATTGTGG - Intergenic
1048613414 8:136048700-136048722 ACTGGTGGTGGGGATCAGTGAGG - Intergenic
1048769411 8:137879878-137879900 GATGTTGGAGGGGGACATTCTGG + Intergenic
1048993250 8:139773663-139773685 GCGGGTGGTGAGGGACTTTGAGG - Intronic
1049421721 8:142519572-142519594 GGTGGTGGTGGTGGTGATTGTGG + Intronic
1049519535 8:143080874-143080896 GCTGGAGGTGGGGGACGTCCTGG + Intronic
1049602365 8:143513861-143513883 GCTGGTGGGGGTGGACAGGGTGG + Intronic
1049924985 9:400100-400122 GCTGGTGGTGGTGGAGGTGGTGG - Intronic
1049925070 9:400430-400452 GCTGGTGGTGGTGGAGGTGGTGG - Intronic
1049925096 9:400530-400552 GCTGGTGGTGGTGGAGGTGGTGG - Intronic
1049925127 9:400647-400669 GCTGGTGGTGGTGGAGGTGGTGG - Intronic
1049925147 9:400722-400744 GCTGGTGGTGGTGGAGGTGGTGG - Intronic
1049925202 9:400926-400948 GATGGTGGTGGTGGATGTTGTGG - Intronic
1049980772 9:901874-901896 GCTGATGGTGTGGGCCATGGGGG - Intronic
1053690677 9:40585163-40585185 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054274128 9:63052328-63052350 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1054301935 9:63386134-63386156 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054400712 9:64712640-64712662 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054434320 9:65196957-65196979 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1054496070 9:65824724-65824746 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic
1055396392 9:75879559-75879581 GGTGGTGGTGGTGGAGATGGTGG + Intergenic
1056574305 9:87843268-87843290 GCTGGTGGGGTGGGACAGGGAGG + Intergenic
1056615495 9:88161786-88161808 GCAGGGGGTGGGGGAGGTTGTGG + Intergenic
1056719087 9:89058207-89058229 GATGGTGGTGGAGGACATGGTGG + Intronic
1056719111 9:89058308-89058330 GATGGTGGTGGAGGACATGGTGG + Intronic
1056719336 9:89059303-89059325 GACGGTGGTGGAGGACGTTGTGG + Intronic
1056719395 9:89059553-89059575 GGTGGTGGTGGAGGACGTGGTGG + Intronic
1056719419 9:89059651-89059673 GATGGTGGTGGAGGACGTGGTGG + Intronic
1056719430 9:89059689-89059711 GATGGTGGTGGAGGACATGGTGG + Intronic
1056719454 9:89059778-89059800 GATGGTGGTGGAGGACGTTGTGG + Intronic
1056955246 9:91075959-91075981 GCTATTGGTGGGGGAAAATGCGG - Intergenic
1057196592 9:93119057-93119079 GGTGGTGGGGGGGGACATGGAGG - Intergenic
1057229121 9:93308322-93308344 GCTGCTGGTGGAGGACCCTGGGG - Exonic
1057296349 9:93845322-93845344 GATTGTGGGGAGGGACATTGTGG + Intergenic
1058105761 9:100969901-100969923 GCTGCTGGTGGGAGTCACTGGGG + Intergenic
1059052499 9:110941706-110941728 GCGGGTAGTGGTGGTCATTGTGG - Exonic
1059465730 9:114467618-114467640 GCAGGTGCTGGGGGACAGGGTGG + Intronic
1060247381 9:121957805-121957827 GTTGGGGGTGGGGGTCGTTGTGG + Intronic
1060389734 9:123268049-123268071 GCAGGTGTTGGAGGACATTGGGG - Intronic
1061163927 9:128911634-128911656 GCTGGGGGTGGGGGACAGGATGG - Intronic
1061367866 9:130181922-130181944 CCTGGGGGTGGGGGACGCTGGGG + Intronic
1061529316 9:131197845-131197867 GTTGGTGGTGGGGCAGATGGGGG - Exonic
1061641830 9:131964316-131964338 GCTGGTGGTGGAGGTGATGGTGG + Intronic
1061904486 9:133689724-133689746 ACTGGGGGTGGGGGACAGGGAGG - Intronic
1062098411 9:134714777-134714799 GGTGGTGGTGGAGGTGATTGTGG + Intronic
1062098437 9:134714894-134714916 GGTGGTGGTGGAGGTGATTGTGG + Intronic
1062117962 9:134819173-134819195 GCTGGTGGTGGGGAACCTGAGGG + Intronic
1062291610 9:135797788-135797810 GGTGTGGGTGGGGGACACTGAGG - Intergenic
1062631995 9:137467246-137467268 GCTGGTGCTGGGGGACGCTGGGG - Intronic
1203621330 Un_KI270749v1:131279-131301 GCTGGTGGTAGGGGGCAGGGTGG + Intergenic
1185734963 X:2489460-2489482 GCTGATGGTGGGGTACCTGGAGG + Exonic
1186756988 X:12681954-12681976 GCTGGGGGTGGAGGAGAATGAGG - Intronic
1187748356 X:22433491-22433513 GCTGTTGGTGGGGGGCACAGTGG + Intergenic
1188003922 X:25004880-25004902 GCTGGTCAGGGGGGCCATTGTGG + Exonic
1188585820 X:31773989-31774011 GGTGATGGTGGGTGACCTTGAGG - Exonic
1188704270 X:33306570-33306592 GATGGGTGTGGGGGACATGGAGG + Intronic
1189281337 X:39821718-39821740 GGTGGTGGTGGCGGGGATTGGGG - Intergenic
1191251289 X:58261332-58261354 CCTGGAGGTAGGGGACTTTGAGG + Intergenic
1191252458 X:58266109-58266131 CCTGGTGGAAGGGGACTTTGAGG - Intergenic
1191669626 X:63737172-63737194 TCTGGTCGTGGGGGAGATTCTGG - Intronic
1192218825 X:69182922-69182944 GCTGGGGGTGGGGGGCAGTGAGG + Intergenic
1192495928 X:71616685-71616707 GCTGGTGGTGGTGGTCGTGGTGG - Exonic
1193057413 X:77168415-77168437 GCTGGTGGTGGGGCAAAGTAAGG + Intergenic
1193812901 X:86072817-86072839 GCTGGGGATGGGAGACAGTGGGG - Intergenic
1194706146 X:97178109-97178131 GCTGGGGATGGGGGGCCTTGGGG + Intronic
1195108475 X:101623076-101623098 GCTGGTGGGAGGGGAAATTGGGG + Exonic
1195280691 X:103330127-103330149 GCTGGTGGGAGGGGAAAGTGGGG + Intergenic
1196763427 X:119221476-119221498 GGTGGTGGTGGTGGATATGGTGG + Intergenic
1197518885 X:127472972-127472994 GCTGTTAATGGGGGGCATTGTGG + Intergenic
1198214214 X:134542459-134542481 GCAGGTGGGGGTGGACATGGGGG + Intergenic
1199074991 X:143516137-143516159 GTTGGTGGTGGAGGAGATGGAGG - Intronic
1200050347 X:153426181-153426203 GGTGGGGATGGGGGACAGTGAGG - Intergenic
1200827031 Y:7657061-7657083 GCTGGTGGTGGACGACATCATGG + Intergenic
1200886945 Y:8280212-8280234 GCTAGTGGTGGATGACATTGTGG + Intergenic
1200909540 Y:8517633-8517655 GCTGGTGGTGGACGACATCATGG - Intergenic
1202021245 Y:20467021-20467043 GGTGGAGGTGGGGGAGATTTTGG + Intergenic
1202584329 Y:26408426-26408448 GCTGGTGGTAGGGGGCAGGGTGG - Intergenic