ID: 1105898357

View in Genome Browser
Species Human (GRCh38)
Location 13:24737016-24737038
Sequence TGACCTACGAAGTTTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105898357_1105898365 23 Left 1105898357 13:24737016-24737038 CCATATCTAAACTTCGTAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1105898365 13:24737062-24737084 ACTGGGTTTCCTCCTTTTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 304
1105898357_1105898362 20 Left 1105898357 13:24737016-24737038 CCATATCTAAACTTCGTAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1105898362 13:24737059-24737081 GACACTGGGTTTCCTCCTTTTGG 0: 1
1: 0
2: 0
3: 49
4: 1085
1105898357_1105898363 21 Left 1105898357 13:24737016-24737038 CCATATCTAAACTTCGTAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1105898363 13:24737060-24737082 ACACTGGGTTTCCTCCTTTTGGG 0: 1
1: 0
2: 0
3: 50
4: 305
1105898357_1105898360 5 Left 1105898357 13:24737016-24737038 CCATATCTAAACTTCGTAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1105898360 13:24737044-24737066 GTGGACAGATCTGAAGACACTGG 0: 1
1: 1
2: 3
3: 6
4: 178
1105898357_1105898364 22 Left 1105898357 13:24737016-24737038 CCATATCTAAACTTCGTAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1105898364 13:24737061-24737083 CACTGGGTTTCCTCCTTTTGGGG 0: 1
1: 0
2: 3
3: 25
4: 271
1105898357_1105898361 6 Left 1105898357 13:24737016-24737038 CCATATCTAAACTTCGTAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1105898361 13:24737045-24737067 TGGACAGATCTGAAGACACTGGG 0: 1
1: 0
2: 2
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105898357 Original CRISPR TGACCTACGAAGTTTAGATA TGG (reversed) Intergenic
909461147 1:75916017-75916039 TGACCGACAAAGGTTACATACGG - Intergenic
912439057 1:109684691-109684713 TGTCCTATGCAGTTGAGATAAGG + Intronic
912441578 1:109703136-109703158 TGTCCTATGCAGTTGAGATAAGG + Intronic
912942883 1:114060580-114060602 TGACCTAGGAAATTTGAATATGG + Intergenic
917448543 1:175127294-175127316 TGTCCTATGCACTTTAGATATGG - Intronic
917588372 1:176451844-176451866 TGTCCTATGCAGTTGAGATAAGG + Intergenic
1066976105 10:42368963-42368985 TGACCTCCAATGTTTAGATATGG + Intergenic
1068423302 10:56823208-56823230 TGCCCTATGCAGTTAAGATAAGG + Intergenic
1071119218 10:82258745-82258767 TGTCCTTCAAAGTTTAGATGAGG + Intronic
1072323330 10:94272198-94272220 TGTCCTATGCAGTTGAGATAAGG - Intronic
1077575537 11:3380098-3380120 TGACCTCCAACATTTAGATATGG + Intergenic
1079071956 11:17354700-17354722 TGACCTACAAAATGAAGATAGGG - Intronic
1080217589 11:29863084-29863106 TGACCTAGAAAATTTAGATTGGG - Intergenic
1085332061 11:75660664-75660686 TGACCTGGGAAGATTAGAGAAGG - Intronic
1086618736 11:88858523-88858545 TGACCAAATAAATTTAGATATGG + Intronic
1092530105 12:9336820-9336842 TGTCCTATGCAGTTGAGATAAGG - Intergenic
1097911065 12:64969588-64969610 TGACCTAGGAAGTTGAGAGCTGG + Intergenic
1097990782 12:65830631-65830653 TGACTTACAAAGTTTATATTTGG + Intronic
1098797740 12:74913503-74913525 TAACATATGAAGGTTAGATAGGG - Intergenic
1101131163 12:101692655-101692677 TGAGCTACTATGTTAAGATAAGG + Intergenic
1105898357 13:24737016-24737038 TGACCTACGAAGTTTAGATATGG - Intergenic
1111387278 13:87543298-87543320 TGTCCCACGTAGTTTAAATAAGG - Intergenic
1112252351 13:97793693-97793715 TGTCCTATGCAGTTGAGATAAGG - Intergenic
1118637145 14:67758286-67758308 TGACCTACAACTTTTAGATTAGG - Intronic
1125775590 15:42209583-42209605 TGACCTACGATGTTTTCCTAGGG - Intergenic
1126879002 15:53074344-53074366 TGACCTCAGAAGTTCAGATTAGG - Intergenic
1130654598 15:85783392-85783414 TGGCCTAAGATGTTTAAATATGG - Intronic
1134474026 16:14555659-14555681 GGTCCTTCCAAGTTTAGATAGGG + Exonic
1136654117 16:31699562-31699584 TGACCTCCAAAGTTTGGATGTGG - Intergenic
1136654478 16:31701745-31701767 TGACCTCCAAAGTTTAGATGTGG - Intergenic
1139282025 16:65779311-65779333 TGACTTACGAGGTTTATTTAGGG + Intergenic
1145290579 17:21542556-21542578 TGACCTCCAGAGTTTAGATTTGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1156603638 18:38639866-38639888 TGTCTTACGCAGTTGAGATAAGG - Intergenic
1163942644 19:20509192-20509214 TGTCCTATGCAGTTGAGATAAGG - Intergenic
1163990864 19:20998161-20998183 TGACCTCCAAAGTTCAGATGTGG - Intergenic
1163993200 19:21018637-21018659 TGACCTCAAATGTTTAGATATGG - Intergenic
1164004679 19:21137530-21137552 TGAACTCCAATGTTTAGATATGG + Intergenic
1164005059 19:21141047-21141069 TGACCTCAAATGTTTAGATATGG - Intergenic
1164272820 19:23688217-23688239 TAACCTCCAATGTTTAGATATGG + Intergenic
1164896402 19:31881056-31881078 TGTCCTAAGAAGTTTGGAGAAGG + Intergenic
1167514032 19:49912561-49912583 TGATCCACGCAGTTTAGATATGG + Intronic
1168712171 19:58507794-58507816 TGTCCTATGCAGTTGAGATAAGG + Intronic
926643075 2:15258559-15258581 TGTCCTACGCGGTTGAGATAAGG + Intronic
927364803 2:22282022-22282044 GAAACTACGATGTTTAGATATGG + Intergenic
934877448 2:97937919-97937941 TCACTTACGAAGTTTAGTTTGGG - Intronic
941511454 2:166416066-166416088 TGTCCTATGCAGTTGAGATAAGG + Intronic
942464228 2:176190199-176190221 TGAGCTCCTAAGTCTAGATAGGG - Exonic
944493821 2:200285737-200285759 TGACCCCTGAAGTTTAGATAAGG + Intergenic
1169021395 20:2333860-2333882 TGACCTCCGAGGTTCAGAAAGGG - Intronic
1172651570 20:36506510-36506532 TGACCTATGTATTTTGGATAAGG - Intronic
950231265 3:11277842-11277864 TGTCTTACGCAGTTGAGATAAGG - Intronic
964926217 3:161961704-161961726 TGACATTGGAAGTTTAGATTAGG + Intergenic
967300884 3:188010861-188010883 TGTCCTACGCAGCTGAGATAAGG - Intergenic
972940691 4:44191606-44191628 TGTCCTATGAGGTTGAGATAAGG + Intronic
975729130 4:77320451-77320473 TGTCCTATGCAGTTGAGATAAGG - Intronic
979027213 4:115592754-115592776 TGACTTACACAGTTGAGATAAGG + Intergenic
979075090 4:116260945-116260967 TGTCCTATGCAGTTGAGATAAGG + Intergenic
979765585 4:124461791-124461813 TGTCCTATGTAGTTGAGATAAGG + Intergenic
980081541 4:128349991-128350013 TGACGTAAGGAGGTTAGATAGGG + Intergenic
980600538 4:135018979-135019001 TGTCTTATGAAGTTGAGATAAGG - Intergenic
981876909 4:149557910-149557932 GGCACTACGAAGTTTAGAGAAGG - Intergenic
986355442 5:6920300-6920322 TGATCTACCAAGTTAAAATAAGG - Intergenic
1000487169 5:161861583-161861605 TCAGCTACTAAGTCTAGATATGG - Intronic
1003316126 6:5013668-5013690 TGACCTGCAGACTTTAGATATGG + Intergenic
1008451995 6:51663203-51663225 TGAGCTGCCAAGTTTAGAAAAGG - Intronic
1009506500 6:64487421-64487443 TGACCTAAATAGATTAGATATGG - Intronic
1009900303 6:69801091-69801113 TGATCTCCAAAGTTTAGGTATGG - Intergenic
1012168568 6:95989961-95989983 TGTCCTATGCAGTTGAGATAAGG + Intergenic
1013923165 6:115434885-115434907 TGACCTACGAAGTATATGGAGGG + Intergenic
1025239337 7:57258051-57258073 TGACCTCCAGAGTTTAGATGTGG + Intergenic
1025797736 7:64755690-64755712 TGACCTCCAAAGTTTAGATGTGG - Intergenic
1026028178 7:66764506-66764528 TGACAAAGGATGTTTAGATATGG - Intronic
1028450248 7:90974006-90974028 TGTCTTACGAGGTTGAGATAAGG - Intronic
1031728525 7:125267530-125267552 TGTCCTATGAAGGTTAGCTAAGG - Intergenic
1038197204 8:25379263-25379285 TGTCCTATGCAGTTGAGATAAGG - Intronic
1042727153 8:71890441-71890463 TGAGCTAGGAAGTTGACATAAGG + Intronic
1043245014 8:77987793-77987815 TGACCTCTGCAGTTTAGAGAAGG + Intergenic
1043912304 8:85877097-85877119 TGATCTAAAAAGTTTAGAGATGG - Intergenic
1044630771 8:94276584-94276606 TAAGCTACGAAGTTTTGGTATGG - Intergenic
1046442394 8:114274713-114274735 TGAGATATGAAGTTTAAATATGG + Intergenic
1047911317 8:129533023-129533045 TAACCTTCGAAGTGAAGATAAGG + Intergenic
1058143669 9:101385375-101385397 TGTCTTACGCAGTTGAGATAAGG - Intergenic
1058479388 9:105375458-105375480 TGACCTGGGCAGGTTAGATAAGG + Intronic
1059523178 9:114963032-114963054 TGTCCTATGCAGTCTAGATAAGG - Intergenic
1186634471 X:11387475-11387497 TTACCTGCGAAGTTCAAATAAGG - Intronic
1195902472 X:109813378-109813400 TGACCTGGCAAGTTTAGAAATGG - Intergenic