ID: 1105898456

View in Genome Browser
Species Human (GRCh38)
Location 13:24738227-24738249
Sequence CTTTCTCCCAGCACTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 388}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105898456_1105898463 5 Left 1105898456 13:24738227-24738249 CCAGGCCCAGTGCTGGGAGAAAG 0: 1
1: 0
2: 0
3: 49
4: 388
Right 1105898463 13:24738255-24738277 TCTGAAAAACCTGCTGCCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 186
1105898456_1105898464 12 Left 1105898456 13:24738227-24738249 CCAGGCCCAGTGCTGGGAGAAAG 0: 1
1: 0
2: 0
3: 49
4: 388
Right 1105898464 13:24738262-24738284 AACCTGCTGCCAGGGGCCTGTGG 0: 1
1: 0
2: 1
3: 34
4: 329
1105898456_1105898462 4 Left 1105898456 13:24738227-24738249 CCAGGCCCAGTGCTGGGAGAAAG 0: 1
1: 0
2: 0
3: 49
4: 388
Right 1105898462 13:24738254-24738276 GTCTGAAAAACCTGCTGCCAGGG 0: 1
1: 0
2: 0
3: 26
4: 162
1105898456_1105898461 3 Left 1105898456 13:24738227-24738249 CCAGGCCCAGTGCTGGGAGAAAG 0: 1
1: 0
2: 0
3: 49
4: 388
Right 1105898461 13:24738253-24738275 TGTCTGAAAAACCTGCTGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105898456 Original CRISPR CTTTCTCCCAGCACTGGGCC TGG (reversed) Intergenic
900356967 1:2269719-2269741 CCTCCTGCCAGCCCTGGGCCCGG - Intronic
900544495 1:3220879-3220901 CTTTCTCCCAAGGCTGGGCTAGG - Intronic
901047442 1:6405800-6405822 CTAGCGCCCAGCACAGGGCCTGG - Intergenic
902439180 1:16418093-16418115 TTCTCTCCAAGCACTGGGCCTGG + Intronic
902447143 1:16474565-16474587 CTTTCTGCCAGGACTGGGTTAGG - Intergenic
902710414 1:18235680-18235702 GTTTCTTACAGCACAGGGCCTGG - Intronic
902934468 1:19754828-19754850 CTGTGTGCCAGCCCTGGGCCGGG + Intronic
902992737 1:20200622-20200644 CTGCCTCCCTGCACTGGGCTGGG - Intergenic
903033465 1:20479648-20479670 CCTTCTCCCTGCACAGGGCCTGG - Intergenic
904203897 1:28840045-28840067 CTAGCACCCAGCACAGGGCCAGG - Intronic
904428887 1:30449174-30449196 CTGCCTGCCAGCCCTGGGCCTGG + Intergenic
904495026 1:30881701-30881723 CATGCTCCCAGCACCTGGCCTGG - Intronic
905234184 1:36534509-36534531 CTTCCCCCCAGCTTTGGGCCAGG - Intergenic
905284153 1:36868379-36868401 CTTTCTCCCAGCATGGCTCCTGG + Intronic
905396981 1:37673034-37673056 AATTCACCCAGCACTGTGCCAGG + Intergenic
906111369 1:43324351-43324373 ATCTTTCACAGCACTGGGCCTGG + Intergenic
906238090 1:44223758-44223780 CCCTCTCCCAGCACAGGGCCAGG - Intronic
906409478 1:45567376-45567398 CCTTCTTCCAGCACAGGGCACGG - Intronic
908121460 1:60990051-60990073 ATTGCACCCAGCACTGGGCTGGG - Intronic
909001560 1:70223550-70223572 CTTTCTCCCAATACTGGGAAGGG - Intronic
909087175 1:71181732-71181754 CTTCCTCCCAATACTGGGACTGG + Intergenic
910501717 1:87900104-87900126 GTTCCTCCCAGCACTGGGTCTGG - Intergenic
911119152 1:94277760-94277782 CTTCCTCCCATCACTGTGTCAGG - Intergenic
912511887 1:110195330-110195352 CTCTGCCCCAGCACAGGGCCTGG - Intronic
912808882 1:112778464-112778486 CTAGCACCCAGCACTGTGCCTGG - Intergenic
915528334 1:156489611-156489633 TATTCCCCCAGCGCTGGGCCAGG - Intronic
915604571 1:156942479-156942501 CATTCTCCCAGAAGCGGGCCTGG + Intronic
920175967 1:204102172-204102194 CCTTCTCCCAGTACTGGGGTGGG - Intronic
920591075 1:207219359-207219381 CATTTTCCCAGCACTAGGCTGGG + Intergenic
920674603 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG + Intronic
921641443 1:217559717-217559739 GTTTCTCCCTGAACTGGGCTGGG - Intronic
923181914 1:231528277-231528299 CTTTCTCACATCCCTGGCCCGGG + Intergenic
924456009 1:244219507-244219529 AATTTCCCCAGCACTGGGCCTGG - Intergenic
1063251394 10:4279193-4279215 CTTTCTGCCATGACTGGGGCCGG - Intergenic
1063997906 10:11638337-11638359 CTTTCTCCCATCCCTGAACCTGG + Intergenic
1065254210 10:23849017-23849039 CTTTGTCCTAGGACTGTGCCAGG - Intronic
1065366746 10:24944397-24944419 ATTTCTCCCAGGACTGTCCCAGG + Intronic
1065524524 10:26605942-26605964 CTTTTTCCTAGCACTTGCCCAGG - Intergenic
1065532288 10:26684226-26684248 CTTTTTCCTAGCACTTGCCCAGG - Intergenic
1065902989 10:30224760-30224782 CTTTCTCCCAGCACTTTGGGAGG + Intergenic
1066433057 10:35371184-35371206 CTGTATCCCAGCACTGGGCTGGG - Intronic
1067088268 10:43254076-43254098 CATCCACCGAGCACTGGGCCTGG - Intronic
1067216194 10:44306160-44306182 CCTTCCCCAACCACTGGGCCTGG + Intergenic
1068299668 10:55121890-55121912 ATTTCTCACAGCTCTGAGCCTGG - Intronic
1068924186 10:62517684-62517706 CCCTCTCCCAGCACTGTGCTAGG - Intronic
1072757471 10:98030553-98030575 CTTGCTCCCAGCCCCGGTCCCGG + Exonic
1073070051 10:100787609-100787631 CTTTTTCCCAACGCTGGGCAGGG + Intronic
1073145170 10:101275907-101275929 CCTTCTCCCTGCTCTGGGGCTGG + Intergenic
1073180632 10:101580907-101580929 CTTTCTCCTGGGCCTGGGCCTGG - Intronic
1074151332 10:110762322-110762344 CTGTATACCAGCACTGTGCCAGG - Intronic
1075389571 10:122083006-122083028 CTCTCTTCCAGCACTGGGGACGG - Exonic
1076219253 10:128719704-128719726 CTAGCTCCCTGCACTGTGCCAGG - Intergenic
1076318773 10:129563650-129563672 CTCTCTCCCAGCACTGTCCCTGG - Intronic
1076476732 10:130758811-130758833 CTTGCTCCCAGCTCCTGGCCTGG - Intergenic
1076818118 10:132924533-132924555 CTCTGTCCCAGCTCCGGGCCAGG - Intronic
1077302725 11:1854695-1854717 CTGTCTCCCTGCACACGGCCTGG - Intronic
1077443766 11:2580803-2580825 CATCCTCCTAGCACTGGGTCCGG - Intronic
1077623127 11:3745668-3745690 CTTTCGCCCAGGACTCAGCCTGG - Intronic
1078009898 11:7564851-7564873 CTCTGTACCAGCTCTGGGCCTGG - Intronic
1078389844 11:10927619-10927641 CTTTCTCCAAGCACTCAGCAAGG + Intergenic
1078466214 11:11552441-11552463 ATACCTCCCAGCACGGGGCCTGG + Intronic
1079126423 11:17721174-17721196 CTGTCTCAAAGTACTGGGCCCGG + Intronic
1080897052 11:36455735-36455757 CTGTCTGCCAGCCCCGGGCCTGG + Intronic
1080941637 11:36925010-36925032 CCTTCTTCCACCACTGGGTCTGG + Intergenic
1081804046 11:45880398-45880420 CAATCTTCCAGCACTGTGCCAGG + Intronic
1081993635 11:47350519-47350541 CTTTCTCCCAGCTCAGCGGCTGG + Exonic
1082791798 11:57350700-57350722 CTGACTCCCTGCTCTGGGCCAGG - Intronic
1083655513 11:64227298-64227320 GTTTCTCACAGGACTGGGGCAGG - Intronic
1084177767 11:67432403-67432425 GCTTCACCCAGCACAGGGCCAGG + Intronic
1084190232 11:67495336-67495358 CTTTCCCCCAGCACACAGCCTGG - Intronic
1084255981 11:67943082-67943104 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1084462859 11:69306040-69306062 CTTGTTCCCAGCACTGCCCCCGG + Intronic
1084476669 11:69393401-69393423 CTCTCTTCCTGCACTGGGCATGG + Intergenic
1084816780 11:71652232-71652254 CTTTCTTCCAAAGCTGGGCCTGG - Intergenic
1084915506 11:72426188-72426210 CCTTCTCCCAGCAGGGGGCTAGG - Intronic
1085011477 11:73144183-73144205 ATTTCTCCTACCACAGGGCCTGG + Intergenic
1085479217 11:76807642-76807664 CTTTCTCCCTGCCCTGTGCCGGG + Intergenic
1085798565 11:79566233-79566255 CATTCTCCCAGCACAGAACCTGG - Intergenic
1086509142 11:87537522-87537544 ATTTCTCACTTCACTGGGCCAGG - Intergenic
1088682301 11:112253753-112253775 CTCCCTCCATGCACTGGGCCTGG - Intronic
1089498520 11:118919627-118919649 CTCTCTCACTGCACTGGGCGGGG + Intronic
1090047488 11:123348944-123348966 CTTCCTCCCAGAACTAGGCTGGG - Intergenic
1090239822 11:125174154-125174176 CTGTCTCCCTGCCCTGGACCTGG - Intronic
1090306166 11:125693092-125693114 CTCTCTCCTAGCCCTGGGCAGGG + Intergenic
1091164930 11:133467181-133467203 ATTTTGCCCAGCATTGGGCCTGG - Intronic
1091283970 11:134397801-134397823 CTCTCTGCCAGGACTTGGCCAGG + Intronic
1091360658 11:134976536-134976558 CTCTCTCCCATCCCTGGCCCGGG + Intergenic
1091803019 12:3336692-3336714 CTGTTTCCCTGCCCTGGGCCTGG + Intergenic
1091856229 12:3742531-3742553 ATTTCTCCCAGCAGGGAGCCAGG - Intronic
1092426212 12:8377821-8377843 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1092951130 12:13504601-13504623 CCTTCTCCTGGTACTGGGCCTGG - Intergenic
1094487019 12:30933492-30933514 CTTCCTCTCAGCACTGGGGATGG + Intronic
1095486933 12:42695142-42695164 CTTCCTCACAGCACTGAGGCTGG - Intergenic
1095945952 12:47753515-47753537 CTTCCGCCCAGCCCTGGGCCAGG - Intronic
1096478455 12:51922862-51922884 CTGTCTCCCAGCATTGTGCAAGG + Intronic
1096497222 12:52045561-52045583 AATTCTACCAGCACTGGGCCTGG + Intronic
1097218774 12:57434588-57434610 CTGTCTCCCAACATTGGCCCAGG + Intergenic
1099201202 12:79679194-79679216 CTATCACACAGCACTGAGCCTGG + Intronic
1100103973 12:91146120-91146142 GTATCTCCCAGTACTGGACCGGG + Exonic
1101529755 12:105563161-105563183 CTCTATCCCAACCCTGGGCCAGG + Intergenic
1101933315 12:109033722-109033744 CCTGCTCCCAGCACAGTGCCAGG - Intronic
1102287048 12:111666153-111666175 CTGTGTTCCAGCACTGTGCCAGG + Intronic
1102441097 12:112964456-112964478 ATCTCTCCCAGCCCAGGGCCAGG + Intronic
1102651780 12:114447557-114447579 GTTTCTTCCAGCGCTTGGCCTGG - Intergenic
1103012025 12:117465181-117465203 CTGTGTCCCAGCCCTGGGCCTGG - Exonic
1104690188 12:130819385-130819407 CTCTCTCCCAGTGATGGGCCCGG - Intronic
1105203024 13:18195151-18195173 CTTTCTTCCACCCCTGGGGCTGG + Intergenic
1105803744 13:23936351-23936373 CTGTCTTCCAGCACTGTGCAGGG + Intergenic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106622171 13:31381329-31381351 CTTTCTCCCATCATTGCGGCAGG - Intergenic
1107043617 13:35973584-35973606 CTTTTTGCCAGCACTGGGCTAGG - Intronic
1108991994 13:56671043-56671065 TTATCTCCCAGCAATTGGCCAGG + Intergenic
1112780090 13:102890907-102890929 CCATCACCCAGCACTGTGCCTGG + Intergenic
1113927702 13:113950727-113950749 CTTTCTCCCACAGCTGGGTCTGG + Intergenic
1114680109 14:24477100-24477122 GGTTCCCCCAGCACTGGGCCTGG + Intergenic
1115167425 14:30464699-30464721 CTTCCTCCCAGATTTGGGCCAGG + Intergenic
1117748693 14:58898303-58898325 CTTTAGCACAGCACAGGGCCTGG - Intergenic
1117829940 14:59740187-59740209 CTTGCACCCAGCACAGTGCCTGG + Intronic
1117882250 14:60323506-60323528 CTTTGTCTCAGCACAGGCCCTGG + Intergenic
1118041704 14:61924154-61924176 GTTACTCCCAGCACTGTGCTAGG + Intergenic
1119199216 14:72740669-72740691 CTTTTTCCCTGCCCTTGGCCTGG - Intronic
1119641748 14:76320546-76320568 CCATCTCCCAGCACCGTGCCTGG + Intronic
1121005709 14:90489394-90489416 CCCTGTCCCAGCACTGGGCTGGG + Intergenic
1121224963 14:92314988-92315010 CTCTATCCCTGCTCTGGGCCGGG - Intergenic
1121425500 14:93848154-93848176 CTTTCACACAACACTGGGCTGGG + Intergenic
1121854692 14:97256456-97256478 ATGCCCCCCAGCACTGGGCCAGG - Intergenic
1122356562 14:101126266-101126288 CTTCCTCCCAGCACTTGGCTGGG + Intergenic
1122903971 14:104793507-104793529 CCAGCGCCCAGCACTGGGCCTGG - Exonic
1122940100 14:104977363-104977385 GTCTGTCCCTGCACTGGGCCTGG - Intronic
1123062008 14:105598646-105598668 CCTGCACCCAGCTCTGGGCCTGG - Intergenic
1123086751 14:105720377-105720399 CCTGCACCCAGCTCTGGGCCTGG - Intergenic
1124458387 15:29865916-29865938 CTGTCTCCTAGCACAGTGCCTGG - Intronic
1124932137 15:34131218-34131240 CTGTATCCCAGCACTTGGGCAGG + Intergenic
1127489633 15:59450145-59450167 CTTGAACCCAGGACTGGGCCTGG - Intronic
1127943715 15:63728184-63728206 CTTTCACCTAGAACTGTGCCTGG - Intronic
1128086792 15:64892186-64892208 CTTGCTCCCAGCACTGCTCAGGG + Intronic
1128390619 15:67180241-67180263 CATTCTCTCAGCCCTTGGCCGGG - Intronic
1128613498 15:69091775-69091797 CTTTCTCCCTTCTCTGGGCCTGG - Intergenic
1128689613 15:69713462-69713484 CTGTTTCCCAGCAATGTGCCAGG - Intergenic
1128728451 15:70004992-70005014 CTTTCTCCCTGCCCTGGCCCTGG + Intergenic
1128772436 15:70292301-70292323 CTTTCCCCCTTCACTGGGCCTGG - Intergenic
1129072696 15:72964271-72964293 CTTATTCCAAGGACTGGGCCAGG + Intergenic
1129176212 15:73841507-73841529 CTTTCTCCCAGGTCAGGGGCAGG - Intergenic
1129325504 15:74798414-74798436 CTTTTTCCCAGCACTCAGTCAGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129670118 15:77603070-77603092 CTTTCTCCTGACTCTGGGCCAGG - Intergenic
1129802867 15:78429622-78429644 CTGTCTCCTAGCACAGGCCCTGG - Intergenic
1129814284 15:78538466-78538488 CTTCCTCACAGCACAGTGCCTGG + Intergenic
1130013949 15:80173351-80173373 TTTTCTCCAAGAACTGTGCCAGG - Intronic
1130972338 15:88742521-88742543 CTCTCTCCCAGGACCTGGCCAGG + Intergenic
1132205517 15:99983673-99983695 CTGTCTCCCCGCACTGGGTCTGG + Intronic
1132222724 15:100117002-100117024 CTTCCTTCTAGCCCTGGGCCTGG - Exonic
1132457136 16:30160-30182 CACTCCCCCAGCACAGGGCCTGG + Intergenic
1132570642 16:642460-642482 CTTTCTCCCCGCTGGGGGCCCGG - Intronic
1132696378 16:1203999-1204021 CTCTCCCGCAGGACTGGGCCAGG + Exonic
1132913625 16:2329563-2329585 TTCTCTCCCAGCCCTGGGACTGG - Intronic
1133337092 16:5013284-5013306 CTCTCTCCCAACCCTAGGCCAGG - Intronic
1133545609 16:6803396-6803418 CTTTCTCCCTTCACTGGGAAAGG - Intronic
1134450407 16:14359819-14359841 CTCCATCCCAGCACTGGGCCTGG + Intergenic
1134644537 16:15856001-15856023 TTTTCTTCCAGCACAGGGTCTGG - Intronic
1134844155 16:17425714-17425736 CTTTCCCCCAGCACACAGCCAGG + Intronic
1135956569 16:26961032-26961054 CTCTCTCCCCGCTCTGTGCCAGG + Intergenic
1136614681 16:31390683-31390705 CTTTCTCCCAGGCCTGGAGCTGG - Intergenic
1136776318 16:32873715-32873737 CTTGCTCCCCGGGCTGGGCCAGG + Intergenic
1136894297 16:33987797-33987819 CTTGCTCCCCGGGCTGGGCCAGG - Intergenic
1137505298 16:49049336-49049358 CTCTTTCCCCACACTGGGCCTGG + Intergenic
1138413272 16:56856165-56856187 CTCACTCCCTGGACTGGGCCTGG + Intergenic
1138537193 16:57666453-57666475 CTTTCTGCCAGCATGTGGCCAGG + Intergenic
1138583569 16:57956841-57956863 CTTTATCCCAGCCCTGAGCCAGG - Intronic
1139905772 16:70364777-70364799 CATTCTCCCAGGTCAGGGCCTGG - Intronic
1141678624 16:85530996-85531018 CCTGCTCCCAGCACAGAGCCAGG - Intergenic
1141770168 16:86085153-86085175 ATCTCACCCAGCACAGGGCCAGG - Intergenic
1141998296 16:87648652-87648674 CCCTCTCCCAGCCCAGGGCCGGG - Intronic
1203078733 16_KI270728v1_random:1135824-1135846 CTTGCTCCCCGGGCTGGGCCAGG + Intergenic
1142996718 17:3764806-3764828 CCGTCTCCCTGGACTGGGCCTGG - Intronic
1143175654 17:4953499-4953521 CCTTCTGCCAGGCCTGGGCCGGG + Intronic
1143371953 17:6445802-6445824 CTTTCCCTCAGCTCTAGGCCTGG - Intronic
1145789980 17:27620528-27620550 CTTTATCACAGCACTTGGCATGG - Intronic
1146258196 17:31403980-31404002 CTGCATCCCAGCACTGGGCAGGG + Intronic
1147142044 17:38465577-38465599 CCTTCTGCCACCCCTGGGCCTGG - Intronic
1147338658 17:39741212-39741234 CTCTCTCTCAGCACTGTGCGGGG - Intronic
1148124833 17:45231260-45231282 CCCTCTCCCAGCGCTGGGCTGGG + Intronic
1148341978 17:46878663-46878685 CTTACGCCCAGCACTGAGCCTGG - Intronic
1150293919 17:63998116-63998138 CTGGTTCCCAGAACTGGGCCTGG - Intergenic
1151060328 17:71084804-71084826 CCTTCTCCCAGTAATTGGCCAGG + Intergenic
1151379786 17:73717739-73717761 CAGCCTCCCAGCGCTGGGCCTGG + Intergenic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1152079811 17:78179688-78179710 CTGCCTCCCAGCACAGAGCCAGG - Intronic
1152247191 17:79191201-79191223 CCTTCCTCCAGCACTGGGCAAGG + Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1154494636 18:14946409-14946431 CTCTCTCCCATCCCTGGCCCTGG - Intergenic
1156478366 18:37420662-37420684 CGTTCTCCAAGCATGGGGCCTGG + Intronic
1156798241 18:41075192-41075214 CTTCCTCCCAGCCCCGGGCTTGG - Intergenic
1157368813 18:47091261-47091283 CTTTTATCCAGCAGTGGGCCTGG + Intronic
1157604866 18:48919737-48919759 CATCCTCCAAGCACTGGGCTGGG + Intergenic
1158205178 18:54985073-54985095 CTTTCTCACAGCACTGTGGTTGG + Intergenic
1159852761 18:73546101-73546123 CTTTTTACCAGCAGTGTGCCTGG + Intergenic
1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG + Intergenic
1160657455 19:280874-280896 GTTTCTCCCAGCACAGTGCTGGG - Intergenic
1160683332 19:422511-422533 GTTTCTCCCAGCTCTGGTCCCGG - Intronic
1160984552 19:1832307-1832329 CTCTCTCTCAGCGCTGGGCTGGG - Intronic
1161011552 19:1961626-1961648 CTCTCTTCCAGCACAGGGACTGG - Intronic
1161542495 19:4860544-4860566 CTTTATCCCAGCGATGTGCCAGG + Intronic
1161792687 19:6369992-6370014 CTTTTTCTCATCACTCGGCCAGG - Intergenic
1161796028 19:6387298-6387320 CCAGCTCCCAGCACAGGGCCTGG + Intronic
1161826252 19:6567964-6567986 CTTTCATCCATCACTGGGTCAGG - Intergenic
1162410418 19:10502356-10502378 CTTCCTCGCCTCACTGGGCCTGG - Intronic
1163875134 19:19861397-19861419 CTTTCTCCCAGAGCTGAGCCAGG + Intergenic
1163969180 19:20776083-20776105 CTTCCTCCCAGAGCTGAGCCTGG - Intronic
1163999206 19:21081982-21082004 CTTCCTCCCAGAGCTGAGCCAGG - Intergenic
1164283561 19:23790416-23790438 CTTCCTCCCTGAACTGAGCCAGG - Intronic
1165939137 19:39406684-39406706 CTTCCGCCCGGCCCTGGGCCAGG - Intergenic
1166118778 19:40672324-40672346 GTTTCTTCTAGCACTTGGCCAGG - Intronic
1166354067 19:42216965-42216987 CCTCCTCCCAGCACGGGGCCGGG + Exonic
1166871508 19:45873660-45873682 CTTTCCCCCAACTCTGGTCCAGG + Exonic
1167213347 19:48147892-48147914 CTAGCTCCCAGCACTGGGGCTGG - Intronic
1167321360 19:48799063-48799085 GCTTCTGCCAGCACAGGGCCTGG + Intronic
1167695478 19:51013256-51013278 CCAGCACCCAGCACTGGGCCTGG + Exonic
1167739901 19:51318265-51318287 GCATCTCCCAACACTGGGCCTGG - Intronic
925190088 2:1875618-1875640 CTGTCCCCAAGCACTGGGCCAGG + Intronic
925322954 2:2990988-2991010 ATCCCTCACAGCACTGGGCCTGG + Intergenic
925340574 2:3132670-3132692 CTTCCTCCCTGCACAGGGACAGG - Intergenic
925401252 2:3575047-3575069 CCTCGTCCCAGCCCTGGGCCTGG - Intergenic
925911940 2:8579435-8579457 ATTTCTCCATGCACTGGGACAGG + Intergenic
925987315 2:9226818-9226840 CTCTCTCCCAGCACTCACCCAGG + Intronic
926803534 2:16683708-16683730 GATTCTCCTAGCACAGGGCCAGG + Intergenic
926813975 2:16782065-16782087 CAAGCTCCCAGCACTGTGCCAGG + Intergenic
926833290 2:16988730-16988752 ATTTTTCCAAGCTCTGGGCCAGG + Intergenic
927103823 2:19807637-19807659 CTTTACCCCAGCACTTGGCAGGG - Intergenic
927177681 2:20421976-20421998 CTGTCACCCTCCACTGGGCCTGG - Intergenic
928421448 2:31140101-31140123 CTTTGTCCCAGCAAAGGCCCAGG + Intronic
928590778 2:32812542-32812564 CTTTCTCCCAACAATTGGACTGG - Exonic
929441934 2:41971558-41971580 CTTGCTCCCTGCCCTGGGCATGG - Intergenic
929460448 2:42099205-42099227 CTTGCCCCCAGCCTTGGGCCAGG + Intergenic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
929804216 2:45130456-45130478 CTTTCTCACAACACTGTGGCTGG + Intergenic
930022427 2:47009418-47009440 CTCTCACCCAGTACTGGGCTAGG - Intronic
932296897 2:70632239-70632261 CTGTCTCCCAGGAATGGGTCTGG - Intronic
932836299 2:75041127-75041149 CCTGATGCCAGCACTGGGCCTGG + Intergenic
936058157 2:109277045-109277067 CTTTATCCCAGCACAGAGCATGG - Intronic
936146648 2:109984864-109984886 CTTCCTGGCAGCACTGGCCCAGG + Intergenic
936198044 2:110386615-110386637 CTTCCTGGCAGCACTGGCCCAGG - Intergenic
940011727 2:149061522-149061544 CTTTCTCCCAGCATTTGTCTAGG - Intronic
940270312 2:151882965-151882987 CTGTCTGCCAACACTGGGCATGG + Intronic
940809034 2:158222204-158222226 CTTACTCCCAGCACTGGCCTTGG + Intronic
941693724 2:168528382-168528404 CTTCCTCCCAGCCCTAGGGCTGG + Intronic
941843585 2:170112447-170112469 CTTTCATCCATCACTTGGCCAGG + Intergenic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
942302552 2:174575565-174575587 GTTTCTTCCACCACTGGGCTTGG - Intronic
942503105 2:176612862-176612884 CCGTGTGCCAGCACTGGGCCAGG + Intergenic
943135901 2:183912722-183912744 CTTTCTCCCAAAAATGGGCCAGG - Intergenic
943247328 2:185472957-185472979 CTGGCTCCCAGCACCCGGCCTGG + Intergenic
944431025 2:199633788-199633810 CTCTCTGCCAGCCCTGGGGCTGG + Intergenic
945503883 2:210613847-210613869 CCTTCTCCCAGCACTCGAGCAGG - Intronic
946180152 2:217944047-217944069 GTTGCTCCCAGCAGTGGCCCTGG - Exonic
946199973 2:218065689-218065711 GTTGCTCCCAGCAGTGGCCCTGG - Intronic
947363654 2:229372133-229372155 CTGTCACTCAGCACTGTGCCTGG - Intronic
947670753 2:231934039-231934061 CTGACTCCCAGCACTGCACCGGG + Intergenic
947740531 2:232482821-232482843 CTGACCCCCAGCTCTGGGCCAGG + Intronic
947813033 2:233016090-233016112 CATTCCCTCAGCCCTGGGCCTGG - Intergenic
948883097 2:240870296-240870318 CTTTGTGCCAGCCCTGGGCCAGG + Intronic
1168781963 20:500080-500102 CCTTCTCCTAGCACTGTGCCAGG + Intronic
1168821434 20:776024-776046 CTTTCCCCGAGCTCTGGGCGGGG - Intergenic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1170541347 20:17391607-17391629 CCTTTTCCCAGCACTAGCCCAGG - Intronic
1171046463 20:21812608-21812630 ATTTCTAACAGCACTGGGCTAGG - Intergenic
1172063056 20:32200144-32200166 CTTGCACCGAGCACTGTGCCTGG + Intronic
1172120962 20:32598513-32598535 CTGACACCCAGCACTGGGCCTGG + Intronic
1172269251 20:33644417-33644439 CTTTCTGCCAGCACAAGGACTGG + Exonic
1173622513 20:44447709-44447731 CTAGCACCCAGCACTGTGCCTGG - Intergenic
1175488977 20:59365800-59365822 CTGTCTCCCAGCATTGCGGCAGG - Intergenic
1175862120 20:62156160-62156182 ATCACTCCCAGCACGGGGCCGGG - Intronic
1176977701 21:15341384-15341406 CTGTTTCCCAGCACAGTGCCTGG + Intergenic
1177586355 21:23101420-23101442 ATGCCTCCCAGCACTGGGACAGG - Intergenic
1179104026 21:38382534-38382556 CTTTCTCCTAACACTGGGTTTGG + Exonic
1179166347 21:38938101-38938123 CTCTCTCCCTGCTCTGAGCCTGG - Intergenic
1179641120 21:42747710-42747732 CTGGCCCCCAGCACTGTGCCAGG + Intronic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1180781512 22:18522723-18522745 CTATCTGCCAGTGCTGGGCCTGG - Intergenic
1181238396 22:21462066-21462088 CTATCTGCCAGTGCTGGGCCTGG - Intergenic
1182125320 22:27811594-27811616 CCTTCTCCCATCACAGGCCCTGG + Intergenic
1183299200 22:37050635-37050657 ACTTCTCCCAGCACAGGGCCAGG + Intergenic
1183428052 22:37750243-37750265 CAATCTCCCAGCCCTGGCCCAGG + Intronic
1183697263 22:39430471-39430493 CTTTCTCAGAGCAGAGGGCCAGG + Exonic
1183728855 22:39605774-39605796 CTTTCCCCCAGCTCTCTGCCTGG - Intronic
1183829502 22:40410334-40410356 CTTTGTCCCAGCACTGGTTTTGG + Exonic
1183930822 22:41235178-41235200 GGTTCTCCTGGCACTGGGCCTGG + Exonic
1183974066 22:41500188-41500210 GATTCTCCAGGCACTGGGCCTGG - Intronic
949534599 3:4986320-4986342 CTTTCTCCCAGCCCAACGCCTGG + Intergenic
950131447 3:10549742-10549764 TTCTGTCCCAGCACAGGGCCTGG - Intronic
951126453 3:18990296-18990318 CTTTCTACCACGACTGGGCTTGG + Intergenic
952899488 3:38100026-38100048 CTATCTCTCAGATCTGGGCCAGG + Intronic
953117266 3:40005312-40005334 CTTTCTCACAGCACTCTGCCAGG - Intronic
953449737 3:42996167-42996189 CTTGCTCTCAGCACAGTGCCAGG + Intronic
953850147 3:46459808-46459830 CTCTCTCCCAGGACTGTGTCTGG - Exonic
953885889 3:46714174-46714196 CTTTCTCACAGCACCCGCCCTGG + Intronic
954285602 3:49616866-49616888 ATGTCTCCCAGCAGTGGTCCTGG + Intronic
954894595 3:53964806-53964828 CTTTTTCCCAGCACCATGCCTGG + Intergenic
955228186 3:57078343-57078365 CTTGCTTCCCGCACTGGGCGAGG - Intronic
955326887 3:58015507-58015529 CTAGCACCCAGCACAGGGCCTGG - Intronic
955484921 3:59425710-59425732 TTTTGTCCAAGCACTTGGCCGGG + Intergenic
956182590 3:66531275-66531297 CTTGCTCTGAGAACTGGGCCAGG - Intergenic
956188277 3:66583183-66583205 ATTTCTGCCAGCACTGGGGCTGG + Intergenic
957070890 3:75567125-75567147 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
960000973 3:112731518-112731540 CTTTCTCCCAGGTATGGGGCAGG + Intergenic
961283226 3:125779612-125779634 CTTTCTTCCAAAGCTGGGCCTGG - Intergenic
961658774 3:128457417-128457439 CTCTCCCTCTGCACTGGGCCTGG - Intergenic
963146237 3:141998046-141998068 CTTTCTCTTAGCACAGGGCCTGG + Intronic
966868934 3:184277508-184277530 CTTGTGCCCAGCACAGGGCCTGG + Intronic
967267086 3:187700320-187700342 CTCTCACCCAGCACTGGGGGCGG - Intronic
967298246 3:187986609-187986631 CTGTCTCCCCGCACTGTGTCAGG - Intergenic
968082461 3:195856065-195856087 CTGGCTCCCAGCACAGTGCCAGG + Intergenic
968265773 3:197362267-197362289 CTTCCTCACAGCTCTGGGACAGG + Intergenic
968619218 4:1596220-1596242 CATCCTCGCAGCACAGGGCCAGG + Intergenic
968909376 4:3469710-3469732 CTTGGTCTCAGCCCTGGGCCTGG + Intronic
969014497 4:4094802-4094824 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
969116691 4:4874630-4874652 CTTTCACCCAGCCCTGATCCAGG + Intergenic
969309138 4:6342505-6342527 ATTTCACCCAACACCGGGCCAGG + Intronic
969354897 4:6619575-6619597 CTTCCTCCCTGGACTGGGCACGG + Intronic
969660089 4:8522327-8522349 CTTTGCCCCAGCTCTGGGCGTGG + Intergenic
970067589 4:12116528-12116550 CTTTCTCTCAGTCCTGGGTCTGG + Intergenic
970275008 4:14389817-14389839 CTTTCACCCAGCACAAAGCCTGG + Intergenic
971788677 4:31138713-31138735 CTTTCTCCCAGCACTTTGGGAGG + Intronic
972733701 4:41819451-41819473 CTTTATGTCAGCCCTGGGCCAGG + Intergenic
977180882 4:93872331-93872353 CTGTCTCCCATCTCTGGCCCTGG - Intergenic
977195478 4:94053654-94053676 CTTCCTCCCAGCACTTTGGCAGG - Intergenic
978401921 4:108340421-108340443 CTGTCTCCCTGCACAGTGCCTGG + Intergenic
978643617 4:110901550-110901572 CTGGCACCAAGCACTGGGCCTGG + Intergenic
979588685 4:122451142-122451164 CCTCCTCACAGCACTGGGCAGGG + Intergenic
979822049 4:125187524-125187546 CTATCACCCAACACTGGGCATGG - Intergenic
984822677 4:183896235-183896257 ATTTCACCCAGCGCTGGTCCTGG - Intronic
985595070 5:784370-784392 CTTTCTCCGGGCCCTGTGCCTGG - Intergenic
986132899 5:4947102-4947124 CTTTCTCCCAGGCCTTGGCCAGG - Intergenic
987291046 5:16508885-16508907 CTTACTCCCAGTACTGTGACAGG + Intronic
987386624 5:17336222-17336244 CTAGCTCCCAGGAGTGGGCCTGG - Intergenic
990922889 5:60987205-60987227 CATTCTCCCAAGACTGAGCCAGG + Intronic
992774267 5:80076148-80076170 CTTTAGACCAGCACTGAGCCCGG + Intronic
993783456 5:92098315-92098337 TATTCTCCCAACACTGGGGCTGG + Intergenic
994269513 5:97760388-97760410 CTTTCTCCCACTACTGAGGCAGG - Intergenic
995279989 5:110323342-110323364 CTTCCTCACAGCACAGGGGCTGG + Intronic
995831604 5:116361197-116361219 GGTGCTCCCAGCGCTGGGCCTGG + Intronic
996953904 5:129160761-129160783 CATTCTCCCAAGACTGAGCCAGG - Intergenic
997579065 5:135005900-135005922 GTCCCTCCAAGCACTGGGCCTGG + Intronic
998462409 5:142319579-142319601 CTTCCTCACAGACCTGGGCCAGG - Intronic
999777648 5:154823724-154823746 CTGCCACCCAGCTCTGGGCCTGG + Intronic
1000117587 5:158167901-158167923 CTCTCTCCCATGAGTGGGCCAGG - Intergenic
1000722889 5:164730406-164730428 CTTTCTCACGCCACGGGGCCTGG - Intergenic
1001193091 5:169648511-169648533 TTTGGTCCCAGCACTGTGCCAGG - Intronic
1001574305 5:172751877-172751899 GTTTCTCCCAGCACCAGCCCAGG - Intergenic
1002460222 5:179369608-179369630 CATTCTCCCAGGCCTAGGCCCGG + Intergenic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1004320780 6:14630015-14630037 CTTTCTATCAGAACTGGCCCAGG - Intergenic
1004895011 6:20139918-20139940 CTGTCTCCTATCACTGTGCCTGG + Intronic
1006253555 6:32811344-32811366 CTTTGTCCCAGCCCTGAGCCAGG + Intergenic
1006899962 6:37493648-37493670 CTTTCTCCCAGCCCCTGGCTTGG + Intronic
1006919977 6:37621148-37621170 CTTTCTCCCAGCATGGTGACTGG + Intergenic
1007209008 6:40176640-40176662 CTATCTCCTAGCACCTGGCCTGG - Intergenic
1007228585 6:40331991-40332013 CTTTCTCCCAGCCACGTGCCTGG + Intergenic
1007239241 6:40413373-40413395 CTGCCACTCAGCACTGGGCCTGG + Intronic
1007506350 6:42338129-42338151 CTTCCTCACAGCAGTGAGCCAGG - Intronic
1007937211 6:45743260-45743282 CTTCCTCCCTGCGTTGGGCCAGG + Intergenic
1009160954 6:60281809-60281831 CTTACACCCTGCACTGGGCCAGG + Intergenic
1011082900 6:83509113-83509135 CTTTGCGCCAGCACTGGTCCTGG - Intergenic
1016834278 6:148461674-148461696 CTTTCTCCAGCCACAGGGCCAGG - Intronic
1018375017 6:163202134-163202156 CCTTCTCCCAGCAGCCGGCCGGG - Intronic
1018837481 6:167496239-167496261 CTTTGAGCCAGCTCTGGGCCAGG + Intergenic
1018890015 6:167976650-167976672 CATTCCCCCAGCACTGTGCGGGG + Intergenic
1018956011 6:168410974-168410996 CTGCCTCCCAGCAGTGGGCAGGG - Intergenic
1019299137 7:294818-294840 CTGGCTCCCAGCACAGGGCTTGG - Intergenic
1019401365 7:855905-855927 CTGTCTGCCTGCCCTGGGCCGGG + Intronic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019450297 7:1094197-1094219 CCTTCTCCCATCACCGGGGCTGG + Intronic
1019514569 7:1434064-1434086 CGTTCTCCCAGGACTGGGGCTGG - Intronic
1019567631 7:1692404-1692426 CTCTCTCCCAAGCCTGGGCCGGG + Intronic
1020006607 7:4786680-4786702 TGTTCTCACAGCACTGGGGCAGG + Intronic
1020067588 7:5200855-5200877 CTCTCTCCCTGCAAAGGGCCTGG - Intronic
1020591803 7:10148192-10148214 CTTTCTTCCAGTTCTGGGGCAGG - Intergenic
1023990694 7:45126525-45126547 CATTTCCCCAGCACTGGGCCTGG - Intergenic
1024325363 7:48105287-48105309 GCTTCTCCCAGCACTGGGGCTGG - Intronic
1025093140 7:56079342-56079364 CTTTCTCCCAGGACTGGCACAGG + Intronic
1025814979 7:64903053-64903075 CTTCCTCCCTGAACTGAGCCCGG - Intronic
1026994331 7:74606029-74606051 CTTCCTCCCAGCTCTGGGCATGG - Intergenic
1027546955 7:79539324-79539346 CTTTCTCCCACCCCCAGGCCTGG - Intergenic
1029112689 7:98221898-98221920 CGTCCACCCAGCACTGTGCCTGG + Intronic
1029924948 7:104305478-104305500 CTTTCTCTCAGAATTTGGCCTGG - Intergenic
1033361182 7:140640279-140640301 CTGACTCCCAGGACTGAGCCCGG - Intronic
1033648593 7:143323208-143323230 CTTACTCCAGGCACTGTGCCAGG - Intronic
1034167395 7:149036312-149036334 AATCCTCCTAGCACTGGGCCTGG + Intergenic
1034348877 7:150403906-150403928 CTTCCTCCCAACACCAGGCCTGG - Intronic
1035117164 7:156534170-156534192 CCCACTCCCGGCACTGGGCCAGG + Intergenic
1035705356 8:1670536-1670558 CCTGCACCCAGCACTGTGCCTGG + Intronic
1035837525 8:2770585-2770607 ATTTCTCACAGCCCTGGGGCTGG + Intergenic
1036102073 8:5798532-5798554 CTTTCATCCATCACTTGGCCAGG - Intergenic
1036256220 8:7208893-7208915 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1036308270 8:7667477-7667499 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1036361263 8:8078601-8078623 CTTTCTTCCAAAGCTGGGCCTGG - Intergenic
1036757881 8:11483384-11483406 CTTTATCTCAGGACAGGGCCTGG + Intergenic
1036889707 8:12588403-12588425 CTTTCTTCCAAAGCTGGGCCTGG + Intergenic
1038049320 8:23794212-23794234 CTATCTTCCAGCACTGTCCCTGG + Intergenic
1041495513 8:58481575-58481597 ACTGCTCCCAGCACTGAGCCTGG + Intergenic
1044218779 8:89645647-89645669 CTATCACCTAGCACAGGGCCTGG + Intergenic
1046734093 8:117757505-117757527 CTTTCTCACAGCACAAGGCTGGG + Intergenic
1047306317 8:123655750-123655772 CTAGCACCCAGCACAGGGCCTGG + Intergenic
1047505170 8:125473914-125473936 CTGTGTCTCAGCACTGGGCTAGG - Intergenic
1048662319 8:136618689-136618711 CTGTATCCCAGCTCTGTGCCTGG + Intergenic
1049357947 8:142198018-142198040 CCTTCTCCCTGCACTGGGAAGGG - Intergenic
1049494060 8:142921519-142921541 CTTGCACCCAGCATAGGGCCTGG - Intergenic
1049635975 8:143689637-143689659 CGTTCCCACAGCACTGTGCCAGG - Intronic
1049691892 8:143965141-143965163 CTTTCCTGCAGCACTGGCCCTGG + Intronic
1049985579 9:947907-947929 ATTTCTCCCAACAGTGGGCCTGG + Intronic
1051196205 9:14565149-14565171 CTGCCTCCCACCACTGGGGCTGG - Intergenic
1052735954 9:32342785-32342807 CTTTCTCCCAGCACTTTGGGAGG + Intergenic
1053174095 9:35909913-35909935 CCTGCCCCCAGCACAGGGCCAGG + Intergenic
1053279391 9:36807993-36808015 CTAGCTCCCAGCACAGGACCTGG + Intergenic
1054962620 9:70985671-70985693 CTTTGTGCCAGCACTGTGCTGGG + Intronic
1057146053 9:92760215-92760237 GGGGCTCCCAGCACTGGGCCTGG + Intronic
1059453142 9:114383355-114383377 CTCTATGCCAGCACTGAGCCAGG + Intronic
1059931259 9:119263380-119263402 CCTTCTCAAAGTACTGGGCCTGG + Intronic
1060184042 9:121553003-121553025 GTGTCTTCCAGGACTGGGCCGGG + Intergenic
1060329025 9:122648011-122648033 CATTCTCCCAGCTCTGTACCAGG + Intergenic
1060835097 9:126749815-126749837 CTTTGTCCCAGCACTTGGGGAGG - Intergenic
1061303932 9:129722020-129722042 CTGTGTCCCAGCACTGAGCTGGG + Intronic
1062287974 9:135781701-135781723 CTTTATCCTTCCACTGGGCCTGG - Intronic
1062388828 9:136326120-136326142 CTTTGCCACAGCCCTGGGCCTGG - Intergenic
1185544059 X:927279-927301 CTGACTCCCAGCTCTGGGCCTGG + Intergenic
1189276867 X:39792913-39792935 CATTCGCCCAGCTCAGGGCCAGG - Intergenic
1189606282 X:42681713-42681735 CTTTCTCCCAGGTATGGGGCAGG + Intergenic
1190063225 X:47223961-47223983 CTGTCCCCCACCACGGGGCCTGG - Intronic
1190276984 X:48905167-48905189 CTTCGGCACAGCACTGGGCCTGG - Exonic
1192216330 X:69161931-69161953 ATTGCTGCCAGCACTGGCCCCGG + Exonic
1192222159 X:69204607-69204629 GTATCTCCCAGGCCTGGGCCAGG + Intergenic
1195247463 X:103007472-103007494 CCTTATGCCACCACTGGGCCTGG + Intergenic
1195667005 X:107440761-107440783 CATGGGCCCAGCACTGGGCCAGG + Intergenic
1196103310 X:111870154-111870176 CATCCTCCCAGCACTGGGCTTGG - Intronic
1199460023 X:148074113-148074135 ATTTCTCCAACCCCTGGGCCTGG - Intergenic
1199996235 X:153028400-153028422 CTTTTTCCCAGCACTTGACCAGG - Intergenic
1200399223 X:156009566-156009588 CACTCCCCCAGCACAGGGCCTGG - Intronic