ID: 1105898851

View in Genome Browser
Species Human (GRCh38)
Location 13:24740258-24740280
Sequence CTCGCTCCTGTCTGTTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105898848_1105898851 4 Left 1105898848 13:24740231-24740253 CCACCTGGGGTGGCGTAAGTGTC 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1105898843_1105898851 26 Left 1105898843 13:24740209-24740231 CCAAGCTGGGGAGGCACACAGGC 0: 1
1: 0
2: 2
3: 38
4: 282
Right 1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1105898849_1105898851 1 Left 1105898849 13:24740234-24740256 CCTGGGGTGGCGTAAGTGTCTTT 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105898851 Original CRISPR CTCGCTCCTGTCTGTTGTGT GGG Intergenic
900476363 1:2878204-2878226 CTGGCTGCTGGCTGTTGTGGGGG + Intergenic
901164298 1:7206720-7206742 CTCACTCCTTTCTGTAATGTGGG + Intronic
902714707 1:18264640-18264662 ATAGCTCCTGTATGTTCTGTAGG - Intronic
903866253 1:26400492-26400514 CTCTCCCCTGTCTGTTTGGTGGG - Intergenic
904289726 1:29476805-29476827 CTCGCTATTGACTGTTGTTTTGG + Intergenic
904604021 1:31689247-31689269 CACGCTCCTGCTTGTTATGTGGG - Intronic
905005880 1:34710045-34710067 CTCCCTCTGGCCTGTTGTGTGGG - Intergenic
907517592 1:55002428-55002450 CTCACTCCTGCCTGCTGTGCTGG + Intronic
917371842 1:174301448-174301470 ATTGCTGCTTTCTGTTGTGTGGG + Intronic
921840593 1:219823873-219823895 GTCGTTCCTTTCTGGTGTGTAGG + Intronic
922916140 1:229259301-229259323 CTCGATCCTCTCTGTTGAGATGG - Intergenic
924890949 1:248279577-248279599 CGAGCTCCTGTCTGTGGAGTTGG + Intergenic
1064147354 10:12836027-12836049 CTGGCTGCTGTCTTTTGTGGGGG + Intergenic
1064705908 10:18072366-18072388 CTCTCTCTTTTCTGTTCTGTTGG + Intergenic
1067059783 10:43072350-43072372 CACGCACCTGTGTGCTGTGTGGG - Intergenic
1069533882 10:69239176-69239198 CTAGCTCCTTTCTCTTGGGTTGG + Intronic
1070693124 10:78542473-78542495 CCCCCTCCTGTCTGTTATCTGGG + Intergenic
1071654894 10:87437097-87437119 CTCTCTTCTGGCTGTAGTGTAGG + Intergenic
1075132618 10:119753456-119753478 TCTGCTCTTGTCTGTTGTGTTGG + Intronic
1075273168 10:121070653-121070675 CTTGCTCCTGTCTCTCCTGTGGG + Intergenic
1075992733 10:126851638-126851660 CTCACTCCTGACAGTTGTGTGGG - Intergenic
1076380736 10:130023134-130023156 CTCACTCCTCCCTTTTGTGTGGG - Intergenic
1085149358 11:74236498-74236520 CTAACTTCTGTCTGTTCTGTTGG - Intronic
1088232140 11:107684119-107684141 CAGGCTCATGTCTATTGTGTGGG + Intergenic
1090066706 11:123509987-123510009 CCCGCTCCTGGCTCCTGTGTAGG + Intergenic
1096301897 12:50436196-50436218 CCCGCTACTGACTGGTGTGTGGG + Intronic
1099780127 12:87183427-87183449 CTCCCTCCTGGCTGTTGTCCTGG - Intergenic
1101506345 12:105350035-105350057 CTAGCTCCTGTTTGCTGTGTTGG + Intronic
1102386056 12:112511241-112511263 CTCACTTCTGTCTTTTGTCTTGG - Intergenic
1102621252 12:114196609-114196631 CTGGCTCCTGTGGGCTGTGTGGG - Intergenic
1104766981 12:131336426-131336448 CTCGGTCCTCTCTGTGGTCTAGG + Intergenic
1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG + Intergenic
1109168330 13:59063671-59063693 CACTCTGCTTTCTGTTGTGTTGG - Intergenic
1113994346 14:16053862-16053884 CTCCCTCGTGTCTGTGGTGGTGG + Intergenic
1118313061 14:64706936-64706958 CTGGCTATTCTCTGTTGTGTTGG + Intronic
1121261201 14:92567460-92567482 CTCACTCATGTGTCTTGTGTTGG + Intronic
1121810656 14:96885854-96885876 CTCTCTCCTGTCTCTTATGAAGG - Intronic
1121904463 14:97727030-97727052 CTAGCTCCTACCTGTTCTGTAGG + Intergenic
1126403344 15:48297212-48297234 CTCGCTCATGTATGTTCCGTAGG + Intronic
1132271516 15:100530502-100530524 CTCGGCCCTCTCTGTTCTGTGGG + Intronic
1133908053 16:10039557-10039579 CTCGCTGCCCTCTGTTCTGTAGG - Intronic
1133924788 16:10183411-10183433 CGCGCTGCTGTCCGTGGTGTTGG + Intergenic
1136076447 16:27820514-27820536 CTCTCTCCTGTTTGCTGTGGGGG - Intronic
1137298416 16:47121230-47121252 CTCCTTCCTGTGTGTTATGTCGG + Intronic
1142138338 16:88461548-88461570 CTCCTTCCCGGCTGTTGTGTGGG + Intronic
1152120106 17:78413319-78413341 CTCGCCCATGACAGTTGTGTGGG + Intronic
1152629923 17:81406316-81406338 CACGCCCCTGTCTGTTGGGTAGG + Intronic
1156711965 18:39958005-39958027 CCCGCTCCTGGCTGTTTTGACGG - Intergenic
1157551648 18:48585978-48586000 CTTGCTTCTGTGTGTTGTGATGG + Intronic
1158363511 18:56704622-56704644 CTTACACCTGTCTCTTGTGTAGG + Intronic
1159976817 18:74723646-74723668 TTCTCCCATGTCTGTTGTGTTGG + Intronic
1160383305 18:78477342-78477364 CTCACACCTGTCAGGTGTGTCGG + Intergenic
1160557178 18:79733529-79733551 CTCGTTCCTGCCTGTTCTGCTGG + Intronic
1166109983 19:40616000-40616022 CTCGCTTCTGTCTGGTGTCTAGG - Intronic
925332983 2:3073213-3073235 CCTTTTCCTGTCTGTTGTGTGGG - Intergenic
936155865 2:110047185-110047207 TTCTCTCCTGAGTGTTGTGTGGG + Intergenic
936188823 2:110324243-110324265 TTCTCTCCTGAGTGTTGTGTGGG - Intergenic
937664407 2:124468432-124468454 CTTGCTTCTTTCTGCTGTGTTGG - Intronic
937701495 2:124867608-124867630 CTCACTCTTGTCTCTTTTGTTGG + Intronic
938537313 2:132257014-132257036 CTCCCTCCTGTCTGTGGCGGTGG - Intronic
938833313 2:135074319-135074341 CTCTCTCCTGTCCTTTCTGTTGG - Intronic
939457995 2:142462936-142462958 CTGGGTCCTGTCTGTAATGTGGG + Intergenic
939598200 2:144154290-144154312 CTCGCTCCTGCATGTTATTTAGG - Intronic
940752794 2:157646225-157646247 CCCTCTCCTTTCTGATGTGTTGG + Intergenic
941607516 2:167618063-167618085 TTCGCTCCTGTTTGTTTTGTTGG - Intergenic
943883856 2:193185507-193185529 CTCCCTCCTGCCTTTTGTGATGG + Intergenic
944168469 2:196748990-196749012 CTTGCTCCTGTTTGTGGTATTGG - Intronic
947828708 2:233124284-233124306 CTGGCTCCTGCCTGTTCTGGGGG + Intronic
948200231 2:236124353-236124375 CTCTCTCCTGTGTGTGGTTTAGG - Exonic
948624944 2:239263148-239263170 CTCCTTCATGTCTGCTGTGTCGG + Intronic
1168745787 20:238897-238919 CTGTTTCCTCTCTGTTGTGTGGG + Intergenic
1170395452 20:15921078-15921100 CTCTCACCTGGCTGTTTTGTGGG - Intronic
1171022381 20:21597777-21597799 CTAGGTCCTTTCTCTTGTGTTGG + Intergenic
1172234447 20:33360926-33360948 CTGTCTTCTGTGTGTTGTGTTGG - Intronic
1173005849 20:39139030-39139052 CTAGCTCCTGTCTTCTGGGTAGG - Intergenic
1174728098 20:52886155-52886177 ATCTCACCTCTCTGTTGTGTTGG + Intergenic
1176031139 20:63012639-63012661 CTCCCTCCAGTCTTTTATGTTGG - Intergenic
1180312923 22:11253653-11253675 CTCCCTCGTGTCTGTGGTGGTGG - Intergenic
1181529619 22:23509816-23509838 ATCACTCCTGTCTCTTGCGTGGG + Intergenic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
951171469 3:19546893-19546915 CTCTGTCCTGGTTGTTGTGTGGG - Intergenic
953173550 3:40529159-40529181 CTCGCCCCTGGCTGTGGTGGTGG + Intronic
958773680 3:98456370-98456392 CTCACTCCTTTTTGTTGTTTAGG - Intergenic
963055255 3:141181428-141181450 CTCGCTCTTGAATGTTGTGGTGG - Intergenic
964802723 3:160573199-160573221 CTAGCACCTGTTAGTTGTGTAGG - Intergenic
965792506 3:172404761-172404783 TTCACTCCTGTCTGTTGTCAAGG + Intergenic
966398196 3:179522862-179522884 CATGGTCCTGGCTGTTGTGTAGG + Intergenic
966609683 3:181855956-181855978 CTCCCTCCTTTCTGCTGTCTAGG + Intergenic
967885215 3:194329031-194329053 ATAGCCCCTGTCTGTTGTGAAGG + Intergenic
970885484 4:20983783-20983805 GTCGCTCCAGTCTGTGCTGTTGG - Intronic
975665576 4:76731937-76731959 CTAGCTACTGTTTGTTGTATGGG + Intronic
979773344 4:124557200-124557222 CTAGCTTCTGGCTGTTGTTTTGG - Intergenic
981795422 4:148589851-148589873 CTCGCTCCTGGCTGTTTTCATGG - Intergenic
982259954 4:153486562-153486584 TTCGGACCTGTCTGTTCTGTTGG + Intronic
987019904 5:13859533-13859555 CTCGATGATGTCTGTTGAGTTGG + Exonic
987257085 5:16166333-16166355 CTAGCTCTTGTCTGTTGAGGGGG - Intronic
999717286 5:154371461-154371483 CTCCCTCCTGTCTGGTCTGAAGG - Intronic
1001193737 5:169653456-169653478 GTAGCTACTGCCTGTTGTGTGGG + Intronic
1001404096 5:171463413-171463435 CTCCCTGCTTTCTGCTGTGTTGG + Intergenic
1001464589 5:171952210-171952232 CTTCCTCCTGTCTGTTCGGTAGG - Intronic
1013977259 6:116092588-116092610 CTCGGTCCTCCCTGTGGTGTAGG + Intergenic
1016029682 6:139324475-139324497 CTCTCTCCTGTATGTTGCATGGG + Intergenic
1017516966 6:155164992-155165014 GTGGCTTCTGTGTGTTGTGTTGG + Intronic
1024144893 7:46504213-46504235 CTCAATCCTGTGAGTTGTGTGGG + Intergenic
1026629435 7:72025583-72025605 TTCGCTCTTGTCTGTTGAGTTGG - Intronic
1028133125 7:87200316-87200338 CAGGCTCCTGTGTGCTGTGTAGG - Intronic
1033169245 7:139068975-139068997 CTTGTTCCTGTGTGTTGTCTGGG + Intronic
1035280154 7:157773330-157773352 CTCTCTCCTGTTTGTTTTCTAGG - Intronic
1037264885 8:17047631-17047653 CTGGCTTCTGTCTGTTGCGATGG - Intronic
1042694286 8:71539365-71539387 CTGTCTCCTGTGTGTTGTGGTGG - Intronic
1042733454 8:71962369-71962391 CTCGCCCCTGTCCCTTGTCTTGG + Intronic
1045426236 8:102068389-102068411 CTCTCTCCTGTTTCTTGCGTAGG + Intronic
1048562574 8:135557426-135557448 CTATCTTCTGTCTTTTGTGTAGG + Exonic
1049418150 8:142504894-142504916 CTGGCTTCTTTCTGTTATGTGGG + Intronic
1049931328 9:459727-459749 CTCACTCATGTCTGGTGTCTGGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1062280343 9:135749075-135749097 CTTGCTCCTGTCTGTCCTGCAGG + Intronic
1189407179 X:40735593-40735615 CTCGCTCCTGTCCCTGGGGTCGG - Intronic
1191595224 X:62936211-62936233 ATCCCTGCTGCCTGTTGTGTGGG + Intergenic
1192264905 X:69531386-69531408 CTTGCTCTGGTCTGCTGTGTGGG + Exonic
1198035941 X:132801367-132801389 CTCCCTCCTTTCTCTTGTGTTGG + Intronic
1200927155 Y:8664914-8664936 CTCTCTCCTGTCTTCTCTGTCGG + Intergenic
1200927988 Y:8671719-8671741 CTCTCACCTGTCTTTTCTGTGGG + Intergenic
1200931200 Y:8698632-8698654 CTCTCTCCTGTCTTCTCTGTGGG - Intergenic
1200939758 Y:8769190-8769212 CACTCACCTGTCTGTTCTGTAGG - Intergenic
1200961657 Y:9001551-9001573 CTCTCCCCTGTCTTTTCTGTGGG + Intergenic
1200982240 Y:9272915-9272937 CTCTCCCCTGTCTTTTCTGTGGG - Intergenic
1201038965 Y:9810094-9810116 CTCTCACCTGTCTTTTTTGTGGG - Intergenic
1201077031 Y:10196414-10196436 CTCCCTCGTGTCTGTGGTGGTGG + Intergenic
1202128162 Y:21586764-21586786 CTCTCCCCTGTCTTTTCTGTGGG + Intergenic