ID: 1105898955

View in Genome Browser
Species Human (GRCh38)
Location 13:24740753-24740775
Sequence CCTGTGGAGCCCATTTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105898947_1105898955 8 Left 1105898947 13:24740722-24740744 CCTCTGTGACCTTGGGCAGCTGC 0: 2
1: 1
2: 1
3: 52
4: 452
Right 1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 187
1105898945_1105898955 14 Left 1105898945 13:24740716-24740738 CCCTCGCCTCTGTGACCTTGGGC 0: 1
1: 1
2: 2
3: 63
4: 376
Right 1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 187
1105898943_1105898955 15 Left 1105898943 13:24740715-24740737 CCCCTCGCCTCTGTGACCTTGGG 0: 1
1: 1
2: 4
3: 43
4: 374
Right 1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 187
1105898941_1105898955 28 Left 1105898941 13:24740702-24740724 CCTGGCTTGGCTGCCCCTCGCCT 0: 1
1: 0
2: 1
3: 37
4: 344
Right 1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 187
1105898948_1105898955 -1 Left 1105898948 13:24740731-24740753 CCTTGGGCAGCTGCTTCCCTGCC 0: 1
1: 1
2: 6
3: 68
4: 680
Right 1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 187
1105898946_1105898955 13 Left 1105898946 13:24740717-24740739 CCTCGCCTCTGTGACCTTGGGCA 0: 1
1: 0
2: 12
3: 90
4: 457
Right 1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG 0: 1
1: 0
2: 2
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105898955 Original CRISPR CCTGTGGAGCCCATTTCCTT GGG Intergenic
900728277 1:4233332-4233354 CCTGGGGAGCCCATGGCCCTAGG + Intergenic
901645897 1:10716557-10716579 CTTGGGGAGCCCCTTCCCTTGGG - Intronic
902689890 1:18104610-18104632 CCAGCAGAGCCCATTCCCTTGGG + Intergenic
902821512 1:18946163-18946185 CCTGTGGGGACCAAATCCTTGGG - Intronic
902935017 1:19758792-19758814 CCTGTGGGGCACCTTTCATTGGG - Intronic
904197510 1:28796768-28796790 CCTGTGGCACACATTGCCTTGGG + Intergenic
907328109 1:53653929-53653951 CCTGTGGCACCCTGTTCCTTAGG - Intronic
910362123 1:86423581-86423603 CCTGTGCAGCCCTTTCCCTCTGG - Intergenic
910875982 1:91878624-91878646 CCTGTGGATCAGATTGCCTTGGG - Intronic
912586170 1:110768014-110768036 CCTGAAGTGCCCTTTTCCTTTGG + Intergenic
913076312 1:115343340-115343362 CTTGTGGAGACCAGTTCCTGTGG - Intergenic
915065378 1:153220227-153220249 CCTGTGCTGCCCATTTGCTTAGG + Intergenic
915554753 1:156655162-156655184 TCTGTGGAGCCATCTTCCTTTGG + Intronic
915913609 1:159928845-159928867 CCTCTGGAGCCCATTTGCCGGGG - Exonic
919131422 1:193455675-193455697 CCTGTGGAAACAATTTCTTTTGG + Intergenic
919824334 1:201492971-201492993 CCTGTGGGGCCCTGTTCCATCGG + Intronic
921105030 1:211968534-211968556 CCTCTGGAGGTCATTTCCTAAGG + Exonic
922161621 1:223082500-223082522 CCTGTGCTGCCCAGTGCCTTCGG + Intergenic
923172282 1:231429021-231429043 CCTGTGGAGCCCCTTTGTTTTGG - Intergenic
923358314 1:233182566-233182588 CCTGTGGAGTAGATTTCATTTGG - Intronic
1062912521 10:1221037-1221059 CCTGCAGAGCCCATTTCCTCTGG + Intronic
1065572744 10:27088687-27088709 TCTGTGTAGCACATTTTCTTAGG - Intronic
1067461091 10:46459216-46459238 CCTGAGGCCCCCAATTCCTTGGG + Intergenic
1067626103 10:47925385-47925407 CCTGAGGCCCCCAATTCCTTGGG - Intergenic
1070483876 10:76911455-76911477 CCTGTGCTGCCAACTTCCTTGGG + Intronic
1072607286 10:96995284-96995306 CCTCTGGAGGCCCTGTCCTTGGG - Intergenic
1073172981 10:101528304-101528326 ACTGTGGAGCCTTTTACCTTTGG - Intronic
1073294695 10:102432049-102432071 CCTGTGAAGCCCGGTTCCTGAGG + Intronic
1073712729 10:106063330-106063352 GCTTTGGAGCTAATTTCCTTGGG - Intergenic
1074459759 10:113626152-113626174 GCTGTGGGGTCCCTTTCCTTTGG - Intronic
1075109502 10:119566726-119566748 CCTGTGGGTCCCATCTACTTGGG - Intergenic
1075810478 10:125221327-125221349 CCTGTGGACCCCACTTTCTCTGG - Intergenic
1076688227 10:132207795-132207817 CCTGTGGAGGGCATTTCCCGTGG - Exonic
1076865592 10:133164829-133164851 CCTGGGGATCCCACGTCCTTGGG - Intronic
1077057954 11:604974-604996 CCTGAGAAGCCCATTGACTTTGG + Intronic
1079028319 11:16966442-16966464 CCTGTGGAGCCCATTTCCAAGGG + Intronic
1080566983 11:33519049-33519071 CATGTGTAGCACATTTTCTTGGG + Intergenic
1080583121 11:33659672-33659694 CCAGTGAAGTCCATTTCTTTTGG + Intronic
1081646999 11:44797034-44797056 CCTGTGGAGATTTTTTCCTTTGG + Intronic
1081978272 11:47249483-47249505 CCTGTGCAACCCAACTCCTTTGG - Intronic
1082986898 11:59176823-59176845 CTACTGGAGCCCCTTTCCTTGGG + Intronic
1084155532 11:67310794-67310816 CCTGTGGAGCTCATGGCCTGGGG - Intronic
1084653850 11:70503954-70503976 CCTGTGGAGCTCAGTTCCATGGG - Intronic
1084711037 11:70843898-70843920 CCTGTGAATGCCATCTCCTTGGG + Intronic
1084715844 11:70872885-70872907 CCTGTAGAGCCCAGCTCCTCGGG + Intronic
1085851909 11:80130616-80130638 CCATTGGAGCCCATATCTTTTGG - Intergenic
1087393089 11:97563965-97563987 TCTGTGGAGCCCTCTCCCTTTGG + Intergenic
1087610938 11:100433293-100433315 CCTGTCCAGCACATTTCCATGGG + Intergenic
1091526362 12:1305135-1305157 TCTGTGGAGCTACTTTCCTTGGG + Intronic
1093007043 12:14062130-14062152 CCTGTGGAGAAAATTTTCTTAGG + Intergenic
1098324288 12:69284962-69284984 CCTGAAGAACCCATTTACTTTGG + Intergenic
1099232173 12:80039640-80039662 AGTGTGGAGGCCATCTCCTTGGG + Intergenic
1103288469 12:119823737-119823759 CCTGTGAAGCTCATTTCTTAAGG - Intronic
1105898955 13:24740753-24740775 CCTGTGGAGCCCATTTCCTTGGG + Intergenic
1105998320 13:25694243-25694265 AATGTGGAGCCCATTGCCTGTGG - Intronic
1107723663 13:43276167-43276189 CCTCTGGGGCTCATTTCCTTAGG - Intronic
1108769393 13:53680177-53680199 CCTTTGGAGCCTATCCCCTTTGG - Intergenic
1117946179 14:61024399-61024421 CCTCTGCAGCCCATTTCCTCAGG + Intronic
1118103150 14:62628280-62628302 CCAGTGGAGCCCAATTTTTTAGG + Intergenic
1124231813 15:27952483-27952505 CCTGTGGAGCACAGTACCCTTGG - Intronic
1127240518 15:57108536-57108558 CCTGTAGAGCCAGTTTCTTTCGG - Intronic
1131177906 15:90221328-90221350 GCTGAGGAGCCCATTCCCATGGG + Intronic
1132543679 16:523261-523283 CCTCGGGAGCCCACTTCCGTCGG - Intergenic
1140805824 16:78531342-78531364 GCAGTGGAGCCCTTTTCCTTAGG + Intronic
1141658585 16:85429523-85429545 CCTGTGGCTCCCATGTCCCTGGG + Intergenic
1141716374 16:85729375-85729397 ACTCTGCAGCCCCTTTCCTTTGG + Intronic
1143622197 17:8087098-8087120 ACTGGGGAGCCCACTGCCTTCGG + Intronic
1144120390 17:12146909-12146931 CCCCTGGAGCCATTTTCCTTTGG + Intergenic
1145334147 17:21898137-21898159 CCATTCGAGCCCATTACCTTTGG - Intergenic
1145335242 17:21906910-21906932 CCTGTCGAGTCCATTACATTTGG - Intergenic
1145377210 17:22362031-22362053 CATATAGAGCCCATTTCCCTGGG + Intergenic
1145696921 17:26795907-26795929 CCGTTCGAGCCCATTACCTTTGG - Intergenic
1145996020 17:29105498-29105520 GCCTTGGAGTCCATTTCCTTGGG - Intronic
1147733532 17:42619192-42619214 ACTGAGGAGCCCATTTACTAGGG - Intergenic
1148339122 17:46863014-46863036 CCTGTGGGGCCCTGTACCTTGGG - Intronic
1148682608 17:49483309-49483331 CCTGTGGAGCCCAAGGCCTGGGG - Intergenic
1149353410 17:55814732-55814754 CCTGTGAGCCCCATTTCCCTGGG - Intronic
1151529493 17:74695450-74695472 CCAGTGCAGCACATTTCCTGTGG + Intronic
1203196885 17_KI270729v1_random:240470-240492 CCATTGGAGTCCATTTCATTTGG - Intergenic
1203204725 17_KI270730v1_random:25890-25912 CCATTCGAGTCCATTTCCTTTGG - Intergenic
1203206490 17_KI270730v1_random:41236-41258 CCATTGGAGTCCATTTCATTTGG - Intergenic
1154043187 18:10878847-10878869 CCTGTGGCCTTCATTTCCTTGGG - Intronic
1156507562 18:37607974-37607996 CCTGTGGACCTCAAGTCCTTGGG + Intergenic
1156558273 18:38092088-38092110 CTAATGGAGCCCATCTCCTTGGG - Intergenic
1160995321 19:1879680-1879702 CCTGTGGAGCCAGGTTCCCTGGG - Intronic
1162870900 19:13586002-13586024 CCTGTAGAGCCCCTCTCCTGGGG - Intronic
1164899425 19:31905946-31905968 CCTGTGGGGCCCATTTACCATGG - Intergenic
1167278758 19:48554241-48554263 CCCCTGGGGCCCACTTCCTTCGG + Intronic
1167873222 19:52390525-52390547 CCTCAAGAGCCCATTTCCTGTGG - Intergenic
1168173238 19:54604743-54604765 CCTGTGAAGCCCATTAGGTTGGG - Intronic
925995721 2:9291489-9291511 ACAGTGGAGACCATTTCCTCCGG - Intronic
928420406 2:31134155-31134177 TCTGTGGAGCAGATTGCCTTCGG - Intronic
929841267 2:45466342-45466364 CCTGTGGATGCCATCTCCTCAGG + Intronic
930068447 2:47345721-47345743 GCTGTGGAATCCATTTCCTCTGG + Intronic
934149349 2:89130564-89130586 CCTGTGGTCCCCAGCTCCTTGGG - Intergenic
934722771 2:96593092-96593114 CCTTTGGTGCCCACTTCATTGGG + Intergenic
935569374 2:104642742-104642764 TCTTTGTAGCCCATTTTCTTTGG - Intergenic
936287553 2:111192494-111192516 CCTGAGGTGCCCACCTCCTTTGG + Intergenic
945436146 2:209820217-209820239 TCTGTTTAACCCATTTCCTTAGG - Intronic
946208569 2:218129049-218129071 CCTGGGCAAGCCATTTCCTTTGG + Intronic
947271589 2:228342573-228342595 CCTCTGTAGCCCAGTTCTTTAGG + Intergenic
948001361 2:234570416-234570438 CGTGGGGAACCCATTTCCTGTGG - Intergenic
948036042 2:234858912-234858934 CCTCTGGAGGCCACTTGCTTTGG - Intergenic
1171473194 20:25388638-25388660 CCAGTGGTGTCCATATCCTTTGG - Intronic
1173055261 20:39605882-39605904 GTTTTGGAGCCCACTTCCTTTGG - Intergenic
1173863443 20:46298880-46298902 CCTGTTGATCCTATTTCCTTGGG + Intronic
1174139507 20:48403289-48403311 CCTGTGGAGCCCCCTTCAATGGG + Intergenic
1175228617 20:57459859-57459881 CCTGGGGAGACCGTTTCCCTAGG + Intergenic
1175549313 20:59806348-59806370 CGTGTGGAGGCCCTTTCCTGTGG + Intronic
1175765337 20:61588582-61588604 TCTGTGGAGCCCGTGGCCTTTGG + Intronic
1175790646 20:61738064-61738086 CCTCTGGGGCCCACCTCCTTGGG + Intronic
1177807712 21:25890373-25890395 GGTTTAGAGCCCATTTCCTTGGG + Intronic
1178412400 21:32376271-32376293 GCTCTGGTGGCCATTTCCTTGGG - Intronic
1178860806 21:36287474-36287496 CCTGTGGGAATCATTTCCTTAGG + Intronic
1178901572 21:36603109-36603131 CCTGAGGGGCCCTTTTCGTTTGG - Intergenic
1183784499 22:40021669-40021691 CCCGTGGAGCCCATCCCCTTGGG + Exonic
1184199595 22:42958248-42958270 CCTCTGGATCCCAATTCCTTTGG + Intronic
1184233774 22:43172246-43172268 CCCTTGGAGCCCATCTCCCTTGG - Intronic
1184349352 22:43933509-43933531 CCTGTGGGTCCCAGCTCCTTAGG - Intronic
950266631 3:11578013-11578035 CCTGTGTGCCCTATTTCCTTAGG - Intronic
950458616 3:13107678-13107700 CCAGTGGGCCCCATTTCCCTAGG + Intergenic
950764038 3:15260165-15260187 CCTGGGGAGCCAACTTCATTAGG - Intronic
954160314 3:48716981-48717003 CCTGTGGATTCGATTTCCCTGGG - Intronic
956593669 3:70943725-70943747 CCTGCATAACCCATTTCCTTTGG - Intergenic
959018945 3:101167464-101167486 CCTGTGAAGCCCATTTTCTTGGG - Intergenic
959308367 3:104697453-104697475 CCTGAGTATCACATTTCCTTAGG - Intergenic
959469456 3:106731804-106731826 CCTTTTGAGCACATATCCTTGGG - Intergenic
960198304 3:114798471-114798493 CCTGAGGAGCAAATTGCCTTGGG - Intronic
961062733 3:123845181-123845203 CCTGTGCAGCCCCTTTCCACAGG - Intronic
970387346 4:15568910-15568932 CTTCTGGGGCCCATTTGCTTAGG + Intronic
971521378 4:27556222-27556244 CCTGTGGAGCACCTCTCCATGGG + Intergenic
982164885 4:152605299-152605321 CCTGTGGAGCCCTTTTCTCCAGG + Intergenic
985266337 4:188154938-188154960 CCTGAGGGGCCCATTTCCCCGGG + Intergenic
985818478 5:2144299-2144321 CATGAGCAGCTCATTTCCTTGGG + Intergenic
986140161 5:5022121-5022143 CTTGTGTAGCACTTTTCCTTGGG - Intergenic
987280819 5:16412030-16412052 CCTGTGGCTCCCTTTTCATTAGG + Intergenic
991613549 5:68472814-68472836 CCAGTGGTACCCATTTCCTCTGG + Intergenic
991658143 5:68923724-68923746 CCTGTGCAGCCCACTCCCTCTGG + Intergenic
991995914 5:72386492-72386514 ACTGTGGAGCCAATTTCCCTTGG - Intergenic
994085186 5:95750656-95750678 CCTGTGCAGGCCATTTTCCTGGG + Intronic
997385638 5:133469969-133469991 GCTGTGGATTCCATTTCTTTAGG - Intronic
997618990 5:135272634-135272656 CCTGAGGAGCCCTTTCCCTGGGG - Intronic
998402156 5:141853598-141853620 ACTGGGGAGCCCCTTTCCCTGGG - Exonic
1000265493 5:159632336-159632358 CCCGTGCAGCCCATCTCTTTGGG + Intergenic
1007360768 6:41353610-41353632 CTTGGGGAGGCCATTTCCTCAGG - Intergenic
1010436221 6:75834355-75834377 CCTGTGGGTCCCAGTTACTTGGG - Intronic
1010682122 6:78809303-78809325 CCAGGGGCGCCCATTTCCCTAGG - Intergenic
1012330714 6:97982486-97982508 CATGCTGAGCTCATTTCCTTTGG + Intergenic
1013816992 6:114110527-114110549 CCAGTAGAGGCCATTTGCTTTGG + Intronic
1016525484 6:144997621-144997643 CCTGTAGAGGTCATTTCTTTGGG - Intergenic
1017650128 6:156573039-156573061 CCTGTCGTCCCCATGTCCTTGGG - Intergenic
1017735077 6:157355318-157355340 CCTATGGAAACCATTTCCCTGGG - Intergenic
1020352657 7:7238596-7238618 CCTGAAGAACCCATTTACTTTGG + Exonic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1020775221 7:12444651-12444673 TCTGTGGAGACCACTTCTTTTGG - Intergenic
1021398134 7:20176029-20176051 GCTGTGGTGCCCATTTCATAGGG + Intronic
1021909480 7:25369907-25369929 GCTGTGGAGCCCGTTGCCTCTGG + Intergenic
1024688936 7:51778826-51778848 CTTTTGGTGCCTATTTCCTTGGG + Intergenic
1025299388 7:57806064-57806086 CATATAGAGCCCATTTCCCTGGG + Intergenic
1026743029 7:72990598-72990620 CCTGGGAACCCCATCTCCTTGGG + Intergenic
1026802879 7:73410983-73411005 CCTGGGAACCCCATCTCCTTGGG + Intergenic
1027029143 7:74875302-74875324 CCTGGGAACCCCATCTCCTTGGG + Intergenic
1027100706 7:75374480-75374502 CCTGGGAACCCCATCTCCTTGGG - Intergenic
1027175663 7:75901583-75901605 CCTGTGCAGCCCACTGCCATTGG - Intronic
1031344934 7:120653155-120653177 CCTGTGGGTCCCAGTTACTTGGG - Intronic
1031449891 7:121902346-121902368 CCTTTGGATTACATTTCCTTTGG + Intronic
1031863693 7:127013452-127013474 CCTGTGGACCACATTTCCTATGG + Intronic
1035321160 7:158030166-158030188 CCTGGTGACCTCATTTCCTTAGG + Intronic
1038160422 8:25031743-25031765 GATGAGGAGCCCATTTTCTTTGG + Intergenic
1039845713 8:41324145-41324167 TCTGTGCAGCCCATCTCCTGGGG + Intergenic
1041778217 8:61548081-61548103 TCTGTGTAGCCCGTTTCTTTTGG + Exonic
1042201402 8:66282261-66282283 CCAGTGGCTCCCATTACCTTTGG + Intergenic
1043391838 8:79799286-79799308 TCTGTAGTGGCCATTTCCTTGGG - Intergenic
1045063231 8:98425962-98425984 CCTGGGGAGCCCCCTCCCTTTGG - Intronic
1049035768 8:140074654-140074676 CCTGAGGGGGCCAATTCCTTAGG + Intronic
1049271145 8:141696933-141696955 CCTGCTGAGCCCCATTCCTTGGG + Intergenic
1049497514 8:142943293-142943315 CCTGGGGACACCATGTCCTTCGG + Intergenic
1049983660 9:927987-928009 CCTGTTGAGCACATATGCTTGGG + Intronic
1051425184 9:16925122-16925144 CCTGTGCTGCCCAGGTCCTTTGG - Intergenic
1052929833 9:34047348-34047370 CCTGTGGAGCCCCTTCGCTAGGG - Intronic
1053794188 9:41709966-41709988 CATATAAAGCCCATTTCCTTGGG - Intergenic
1054150977 9:61604861-61604883 CATATAAAGCCCATTTCCTTGGG + Intergenic
1054182596 9:61922005-61922027 CATATAAAGCCCATTTCCTTGGG - Intergenic
1054470763 9:65535973-65535995 CATATAAAGCCCATTTCCTTGGG + Intergenic
1054655912 9:67666474-67666496 CATATAAAGCCCATTTCCTTGGG + Intergenic
1056731520 9:89170069-89170091 GTTGTGGAGGCCTTTTCCTTGGG + Intronic
1057030844 9:91774136-91774158 CTTGGGGACCACATTTCCTTAGG - Intronic
1058104758 9:100957169-100957191 CCTGTGGATCCCACTCTCTTTGG - Intergenic
1058941975 9:109821805-109821827 CATGGGGAGCCCATTCTCTTAGG + Intronic
1060024221 9:120157267-120157289 ACTGTGGAACCCAGTTCCCTGGG + Intergenic
1060140484 9:121205338-121205360 CTTTTGGAGCCCCTCTCCTTTGG - Intronic
1061541461 9:131279796-131279818 TCTGTGGAGCCCACTGCCTAGGG - Intergenic
1061887304 9:133598251-133598273 CCTGGGGACCCCAGTCCCTTGGG + Intergenic
1186433398 X:9523370-9523392 CCTGGGGTGCCCCTTTCCCTGGG + Intronic
1191025009 X:55904996-55905018 CCTGTGGATTCCATCTCCTGGGG - Intergenic
1193069791 X:77295574-77295596 CCTTTTGAGCCCCTTTCTTTAGG - Intergenic
1197688306 X:129468300-129468322 CCTGTGGGTCCCATTAACTTGGG - Intronic
1198972728 X:142299435-142299457 CCTCAGCAGCCCATTTCCTAAGG - Intergenic
1200108875 X:153728951-153728973 TCTGCTGAGCCCATTTCTTTGGG - Intronic
1200138258 X:153885365-153885387 CCTCTGGAGCCCGTTTCCACAGG - Intronic
1200644106 Y:5760502-5760524 CCTGTAAGGCACATTTCCTTTGG + Intergenic
1202093058 Y:21214238-21214260 TCTCTGGAGCACATTTCTTTTGG + Intergenic