ID: 1105898978

View in Genome Browser
Species Human (GRCh38)
Location 13:24740841-24740863
Sequence TAGGGTAACCAGAATGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105898970_1105898978 12 Left 1105898970 13:24740806-24740828 CCAGCTATGGGCTGGGCCTAGTG 0: 1
1: 0
2: 3
3: 32
4: 389
Right 1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 145
1105898966_1105898978 24 Left 1105898966 13:24740794-24740816 CCGATTTAGGGACCAGCTATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 145
1105898971_1105898978 -4 Left 1105898971 13:24740822-24740844 CCTAGTGTGATATTGACTGTAGG 0: 1
1: 0
2: 3
3: 9
4: 98
Right 1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105898978 Original CRISPR TAGGGTAACCAGAATGGGGG CGG Intergenic
904195533 1:28782601-28782623 TAGGGTGACAGCAATGGGGGTGG - Intergenic
906187827 1:43874813-43874835 TATGGGAACAAGAATGAGGGAGG + Intronic
908062137 1:60362700-60362722 TTGGGTAACCAGGATGGAGGAGG + Intergenic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
915953033 1:160202767-160202789 TTGGGTAAGCATAATGGGGCTGG + Intergenic
917159176 1:172038326-172038348 TAGGGTATCCCGAATGTGGTTGG - Exonic
917457648 1:175199208-175199230 TGGGTTGACCAGAATGTGGGAGG + Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919545110 1:198906479-198906501 TAGTGTAACCAGATTTGGGGTGG - Intergenic
919569823 1:199233945-199233967 TAGGGAAACCAGAAAAGGGCAGG - Intergenic
920125200 1:203688787-203688809 TAGGGCAACAAGAAAGGGTGGGG + Intronic
920728753 1:208462777-208462799 TAGGCTGACCAGAACAGGGGTGG + Intergenic
923260171 1:232260966-232260988 TTGGGTAAGCAGGCTGGGGGAGG - Intergenic
923536852 1:234859101-234859123 TAGGAAAACCATAATTGGGGTGG - Intergenic
924466830 1:244305781-244305803 TAGGGTAACCTGAAGGGGGCTGG - Intergenic
1063023842 10:2157875-2157897 TAGGATAATCAGAATGGGTTTGG + Intergenic
1069552771 10:69375996-69376018 TAGGGTAACATCAGTGGGGGAGG + Intronic
1073208454 10:101780799-101780821 CAGGGAAACCAGAATCCGGGTGG - Intergenic
1073546690 10:104354905-104354927 GAGAGTAACTAGAATGGGGTGGG - Intronic
1073863187 10:107770710-107770732 TAGGCAAAGCAGCATGGGGGAGG - Intergenic
1074508913 10:114095441-114095463 AAGGGTAACCAAAATGGGCAGGG + Intergenic
1077235202 11:1478756-1478778 TAGGGAGACGAGAAAGGGGGCGG - Intronic
1081619147 11:44608733-44608755 TAGGGACACCCGAATGGGGCAGG - Intronic
1083741655 11:64714458-64714480 CAGGGTAACCAGACTGGGAAGGG + Intronic
1084420759 11:69059387-69059409 GCGGGGACCCAGAATGGGGGAGG + Intronic
1090120445 11:124021614-124021636 TAGGGTAACAGAAATGGGGGTGG + Intergenic
1091131711 11:133152230-133152252 TAGGGGAATCAGAGTGGGAGTGG - Intronic
1091865035 12:3826134-3826156 TATGGTAAAGAGAATAGGGGTGG - Intronic
1091963773 12:4721086-4721108 TAGAGCAAGCAGTATGGGGGAGG + Intronic
1092473500 12:8798982-8799004 TAAGGTCACCAGAACGGGAGGGG - Intergenic
1095866022 12:46972907-46972929 TAGGAATACCAGAATGGTGGTGG + Intergenic
1098831363 12:75367152-75367174 TAGGGTACCCAAAAGGCGGGGGG + Intronic
1099127786 12:78787516-78787538 TGAGATAACCAGAATTGGGGTGG + Intergenic
1101261575 12:103037324-103037346 TAGGGTAATGAGAATTGGGAGGG + Intergenic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1102575615 12:113854453-113854475 TGGGGGAAGGAGAATGGGGGTGG - Intronic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1105898978 13:24740841-24740863 TAGGGTAACCAGAATGGGGGCGG + Intergenic
1108581697 13:51833578-51833600 TCGGGTGACAAGAATGGTGGAGG + Intergenic
1114450144 14:22819983-22820005 TAGGGCAACAAGGAAGGGGGGGG - Intronic
1117049594 14:51847009-51847031 CATGGTAACCAGAGGGGGGGAGG + Intronic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1130155340 15:81345535-81345557 AAGGATATCCTGAATGGGGGAGG - Intronic
1130683580 15:86017704-86017726 TAGGGACTCCAAAATGGGGGAGG - Intergenic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1134888007 16:17811484-17811506 TAGGAAAACAAGAATTGGGGAGG + Intergenic
1135674163 16:24401288-24401310 TATGGTACCCATGATGGGGGGGG - Intergenic
1135848367 16:25939798-25939820 TAGGGCAGCCAGAATGAGGAAGG + Intronic
1135991613 16:27222025-27222047 TGGGGTAACTAGAAGGGGGATGG + Intergenic
1137552997 16:49453221-49453243 AAGGGAAGCCGGAATGGGGGAGG - Intergenic
1138458081 16:57132704-57132726 CAGGGCAACCAGTATGGGAGGGG + Intronic
1139842536 16:69893076-69893098 AAGAGTGACCAGCATGGGGGAGG - Intronic
1144239359 17:13295063-13295085 TCGGGTACCCAGAATGATGGAGG + Intergenic
1152000973 17:77645099-77645121 TGGGGGTCCCAGAATGGGGGAGG - Intergenic
1153399408 18:4666911-4666933 TAGGCAAAGCAGCATGGGGGAGG - Intergenic
1153503333 18:5770602-5770624 TAGGGTAAAGAGGATGAGGGGGG + Intergenic
1154082064 18:11267397-11267419 TATGGAGACCAGTATGGGGGTGG + Intergenic
1158181447 18:54719609-54719631 TAGGGAAATTAGATTGGGGGTGG + Intronic
1158488740 18:57891328-57891350 GAGAGCAACCAGAATGGGGTGGG - Intergenic
1159903387 18:74068480-74068502 TGGGGAAACGTGAATGGGGGCGG + Intergenic
1161657784 19:5526360-5526382 GAGGGAAACCAGGATGGGTGGGG + Intergenic
1161847708 19:6721087-6721109 GAGGGGAAGTAGAATGGGGGAGG + Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1164023222 19:21327585-21327607 TAAGGTGAGCAGAATGGGGTGGG - Intronic
1167072209 19:47227850-47227872 TAGAGGACCCAGACTGGGGGAGG + Intronic
926039436 2:9660970-9660992 GAGGGAATACAGAATGGGGGAGG - Intergenic
926286918 2:11495968-11495990 GAGGATAACCAGACTGGGAGAGG + Intergenic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
927200592 2:20575766-20575788 TGGGGTAGCCTGAAGGGGGGGGG - Intronic
928205328 2:29279610-29279632 TAGGGAAACCTGAATCTGGGTGG - Intronic
931989277 2:67773285-67773307 TATTGTAACCAGGAAGGGGGAGG - Intergenic
939349526 2:141016861-141016883 TAGGGTCTACAAAATGGGGGAGG - Intronic
940559279 2:155273836-155273858 TAGGGTAAACAAGGTGGGGGAGG - Intergenic
942303259 2:174582783-174582805 TAGGCTAACCAGAATTGCAGTGG + Intronic
943315483 2:186382153-186382175 TAGGTCAACTATAATGGGGGAGG + Intergenic
944306873 2:198188880-198188902 TGGGGAAGCCAGAAGGGGGGTGG - Intronic
947021546 2:225683012-225683034 TAGGAAGAACAGAATGGGGGGGG - Intergenic
947745269 2:232503899-232503921 AGGGGTAACCAGAATGGAGGTGG - Intergenic
1169300329 20:4436625-4436647 TAGGGTAAGCAGAAAAGGGGAGG - Intergenic
1172032181 20:31989945-31989967 AAGGGAATCCAGATTGGGGGTGG - Intronic
1173338538 20:42133761-42133783 TAGGGGAAACAGTATGTGGGTGG + Intronic
1175443133 20:59004543-59004565 TAGGGAGCCCAGAATTGGGGCGG + Intronic
1177759990 21:25392407-25392429 TCAGGTTACCAGAATTGGGGAGG + Intergenic
1179279296 21:39920861-39920883 GAGGCCAACCAGGATGGGGGCGG - Intronic
1180844516 22:18973875-18973897 CAGGCTTGCCAGAATGGGGGCGG - Intergenic
1181056957 22:20264836-20264858 CAGGCTCACCAGAATGGGGGCGG + Intronic
1181741497 22:24925004-24925026 TAGCGTCAAAAGAATGGGGGAGG - Exonic
1184264450 22:43339659-43339681 TAGAGTGAGGAGAATGGGGGAGG - Intronic
949334836 3:2963016-2963038 TACGGCATCCAGAATGCGGGAGG - Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
957737889 3:84225855-84225877 TAGGGCAACCTGAAGGGGGCTGG + Intergenic
957971458 3:87388135-87388157 TAGCTTAAACTGAATGGGGGCGG + Intergenic
958048852 3:88319271-88319293 TAAGGTAACCAGCAAGGGGCTGG - Intergenic
959912983 3:111785812-111785834 AAGGGCAACCAGAATGGTGGTGG + Intronic
962310280 3:134321557-134321579 AAGGGCAACCAGACTGGGAGGGG - Intergenic
963454067 3:145521733-145521755 CAGGGCAACTAGAAGGGGGGTGG + Intergenic
965735327 3:171813590-171813612 TAGGGTAAATGGAATGGTGGTGG - Intergenic
966921265 3:184613145-184613167 CCGGGCAACCAGAATGGGGAGGG + Intronic
970061113 4:12035667-12035689 TAGGCTAATCATAATTGGGGCGG - Intergenic
976381275 4:84402012-84402034 AAGGTTAAGCAGAATGGGGCTGG + Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
979093389 4:116516253-116516275 TAGGGTAACCTGGAGGGGGCTGG + Intergenic
984778764 4:183505551-183505573 TGGGGTCCCCAGAGTGGGGGTGG + Intronic
987534764 5:19170410-19170432 TAAGGTAACCAGAATTTGGAAGG + Intergenic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
990821155 5:59841780-59841802 GAAGTTAACCAGATTGGGGGAGG + Intronic
993333454 5:86627905-86627927 TAGGGTAGGGAGAATGGGGATGG + Intergenic
994312702 5:98293585-98293607 TAGATTAACCAAAATGGAGGAGG + Intergenic
995482591 5:112608055-112608077 TAGGGCAACCTGAAGGGGGCCGG - Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996537303 5:124591915-124591937 TGGGGTTACCAGAGTGGAGGCGG - Intergenic
999135250 5:149314404-149314426 GAGGGTAACTAGAATGTTGGGGG + Intronic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000431649 5:161159656-161159678 CATGGTAACCAAAATGGGGATGG + Intergenic
1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG + Intergenic
1002074755 5:176701618-176701640 GAGGGTAACCAGCCTGGGGATGG - Intergenic
1004081357 6:12396877-12396899 TATGGTAATCAGACTGGGCGCGG + Intergenic
1005104044 6:22203999-22204021 TAGTTTAACCAGAATGGGCTTGG - Intergenic
1006303972 6:33208148-33208170 CAGGGTACGCAGAGTGGGGGAGG + Intergenic
1006802898 6:36770683-36770705 TAGGGTCTCCAGGAGGGGGGTGG - Intronic
1008727068 6:54434709-54434731 AATGGTAACCAGAGTTGGGGAGG - Intergenic
1011714055 6:90085683-90085705 AAGGGTAACAGGAATGAGGGAGG + Intronic
1012049076 6:94316655-94316677 TAGGGTAACCAGGCAGGTGGTGG + Intergenic
1013108017 6:107042568-107042590 TAGGGCAACCAGACCGGGGGAGG - Intronic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1016739780 6:147514678-147514700 TAGGGTAAATAGTGTGGGGGAGG + Intronic
1017283711 6:152650807-152650829 TAGAGTAGCCAGAATGGAGTGGG + Intergenic
1022727753 7:32996352-32996374 AAGGGCAACCAGAATGGTGTGGG + Intronic
1026491002 7:70863394-70863416 AAGGGAAACCAGAATTGGAGTGG + Intergenic
1037600584 8:20390646-20390668 CAGGGTAACCAGCATGGTGCAGG - Intergenic
1037649809 8:20826051-20826073 TAGGATAACCAGAATGTTGTGGG - Intergenic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1039033781 8:33336947-33336969 TAGGGTAACCAGAATATTAGGGG + Intergenic
1039432316 8:37534585-37534607 GAGAGTAACAAGAATGGTGGAGG + Intergenic
1041119784 8:54574449-54574471 TTGGGTAAGAAGAAAGGGGGTGG + Intergenic
1045225383 8:100239169-100239191 TAGAGTAACCTGAGTGGGAGTGG - Intronic
1051041318 9:12815678-12815700 AAGGGTAACAATAATGGAGGAGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052011849 9:23420233-23420255 CAGGGAAACCAGAATGGAAGGGG - Intergenic
1052366967 9:27622913-27622935 CAGGGTGAAGAGAATGGGGGAGG + Intergenic
1053149470 9:35733372-35733394 TAGGGTAACAAGAAAGTGGACGG - Intronic
1054822880 9:69541255-69541277 TATAGAAAACAGAATGGGGGGGG - Intronic
1056093664 9:83229268-83229290 TAGGGTTTCCAAAATGGGGGAGG - Intergenic
1058924941 9:109653979-109654001 TTGGGAAATCAGAATGGGGTAGG + Intronic
1058931884 9:109728764-109728786 TATGGGAGCCACAATGGGGGTGG - Intronic
1059351451 9:113668182-113668204 TGGGGGAAACAGAATGGTGGTGG - Intergenic
1060998384 9:127887706-127887728 TGGGGTAACCAAAGTGGGAGTGG - Intronic
1061222411 9:129259892-129259914 GCGGGTAACCAGAAAGGGAGTGG - Intergenic
1061389324 9:130308627-130308649 TAGGGTCACCAGCAAGTGGGTGG + Intronic
1188090379 X:25956980-25957002 TAGAGAAGCCAGAATGGGGGAGG - Intergenic
1188368256 X:29336725-29336747 TAGTGTTACCAGATTGAGGGGGG + Intronic
1189301817 X:39957847-39957869 TGGGGAAACAAGAATGGGGTTGG + Intergenic
1189860216 X:45263958-45263980 TAGGGTGAGCTGAATGGGGCAGG + Intergenic
1190454205 X:50610185-50610207 TGAGCTGACCAGAATGGGGGAGG - Intronic
1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG + Intergenic
1196910552 X:120480580-120480602 TAGAGAGACCAGAATTGGGGAGG + Intergenic