ID: 1105899146 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:24741525-24741547 |
Sequence | GGGGTAGCGCCTCGTGGCCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 105 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 101} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1105899139_1105899146 | 20 | Left | 1105899139 | 13:24741482-24741504 | CCAGGAAGCAGACAAGGCACTCA | 0: 1 1: 0 2: 0 3: 18 4: 217 |
||
Right | 1105899146 | 13:24741525-24741547 | GGGGTAGCGCCTCGTGGCCTTGG | 0: 1 1: 0 2: 0 3: 3 4: 101 |
||||
1105899138_1105899146 | 21 | Left | 1105899138 | 13:24741481-24741503 | CCCAGGAAGCAGACAAGGCACTC | 0: 1 1: 0 2: 1 3: 16 4: 184 |
||
Right | 1105899146 | 13:24741525-24741547 | GGGGTAGCGCCTCGTGGCCTTGG | 0: 1 1: 0 2: 0 3: 3 4: 101 |
||||
1105899136_1105899146 | 29 | Left | 1105899136 | 13:24741473-24741495 | CCATTTAGCCCAGGAAGCAGACA | 0: 1 1: 0 2: 1 3: 52 4: 498 |
||
Right | 1105899146 | 13:24741525-24741547 | GGGGTAGCGCCTCGTGGCCTTGG | 0: 1 1: 0 2: 0 3: 3 4: 101 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1105899146 | Original CRISPR | GGGGTAGCGCCTCGTGGCCT TGG | Intergenic | ||