ID: 1105899146

View in Genome Browser
Species Human (GRCh38)
Location 13:24741525-24741547
Sequence GGGGTAGCGCCTCGTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105899139_1105899146 20 Left 1105899139 13:24741482-24741504 CCAGGAAGCAGACAAGGCACTCA 0: 1
1: 0
2: 0
3: 18
4: 217
Right 1105899146 13:24741525-24741547 GGGGTAGCGCCTCGTGGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 101
1105899138_1105899146 21 Left 1105899138 13:24741481-24741503 CCCAGGAAGCAGACAAGGCACTC 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1105899146 13:24741525-24741547 GGGGTAGCGCCTCGTGGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 101
1105899136_1105899146 29 Left 1105899136 13:24741473-24741495 CCATTTAGCCCAGGAAGCAGACA 0: 1
1: 0
2: 1
3: 52
4: 498
Right 1105899146 13:24741525-24741547 GGGGTAGCGCCTCGTGGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105899146 Original CRISPR GGGGTAGCGCCTCGTGGCCT TGG Intergenic