ID: 1105899320

View in Genome Browser
Species Human (GRCh38)
Location 13:24742257-24742279
Sequence TGAAATCTTACCCATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105899313_1105899320 1 Left 1105899313 13:24742233-24742255 CCTGGGGGACCAGCCATATTACT 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1105899320 13:24742257-24742279 TGAAATCTTACCCATGGGGGTGG 0: 1
1: 0
2: 1
3: 10
4: 128
1105899312_1105899320 2 Left 1105899312 13:24742232-24742254 CCCTGGGGGACCAGCCATATTAC 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1105899320 13:24742257-24742279 TGAAATCTTACCCATGGGGGTGG 0: 1
1: 0
2: 1
3: 10
4: 128
1105899314_1105899320 -8 Left 1105899314 13:24742242-24742264 CCAGCCATATTACTTTGAAATCT 0: 1
1: 0
2: 1
3: 17
4: 224
Right 1105899320 13:24742257-24742279 TGAAATCTTACCCATGGGGGTGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105899320 Original CRISPR TGAAATCTTACCCATGGGGG TGG Intergenic
900801977 1:4742932-4742954 TGAAATCTGACCCAGTGGGTCGG - Intronic
900920221 1:5665380-5665402 TGAAATCTTTCCTCTGGGGCTGG + Intergenic
903698356 1:25226726-25226748 TGTAATCTCAACCATGTGGGAGG + Intronic
906481570 1:46202892-46202914 TGAATTCTAGCCCCTGGGGGGGG + Intronic
906708164 1:47909883-47909905 GGAACTGTTACCCAGGGGGGGGG + Intronic
906733738 1:48104877-48104899 TGAATTGCTACCCATGGTGGAGG + Intergenic
912401233 1:109395475-109395497 TGTAATCTTATCAATGTGGGAGG - Intronic
915608380 1:156969912-156969934 TGGAATCTGCCCCATGGGGAGGG + Intronic
917263238 1:173192053-173192075 TGTAATCTTAGCCACTGGGGAGG + Intronic
917409034 1:174738630-174738652 AGGAATCTTACACATGGGGGAGG + Intronic
921333658 1:214064935-214064957 TGTAAACTTACCCATGAGAGCGG - Intergenic
922318031 1:224459596-224459618 TGAAGTCTTTCCCAGGGTGGGGG + Intronic
923086105 1:230704475-230704497 TGAAATTTTCCCCAAGGGGGAGG - Intronic
1071901462 10:90124775-90124797 TGAGATCTTACCCATAGTAGGGG + Intergenic
1074235261 10:111578391-111578413 TGAGATCTCTCCCATGGGGATGG - Intergenic
1080578201 11:33618980-33619002 TGAATTCTAACCCATGGCCGTGG - Intronic
1083578894 11:63812841-63812863 GGAAATCATACCCATCAGGGTGG + Intergenic
1088843124 11:113643327-113643349 AGAAATCTTACACATGTTGGAGG + Intergenic
1089648544 11:119896275-119896297 TGAAATGTTACCACTGGGAGAGG - Intergenic
1090022032 11:123136912-123136934 TGGAATCTTACTTATGGGGCTGG + Intronic
1090336231 11:125968405-125968427 TGAAGTTTTACACATGGGGCAGG + Intronic
1094466728 12:30761571-30761593 TGTAATCTCAGCTATGGGGGAGG + Intergenic
1094556554 12:31505954-31505976 TGTAGTCTTAGCCATGTGGGAGG - Intronic
1094871099 12:34599720-34599742 GGTACTCTTGCCCATGGGGGGGG - Intergenic
1095972288 12:47910548-47910570 TGAAAACTTTCCTATGGGGACGG - Intronic
1097291728 12:57922320-57922342 TGAAAAGTTAGCCATGGTGGTGG + Intergenic
1100068386 12:90679920-90679942 TGAAGTCTTACCAATTGGTGTGG + Intergenic
1100454019 12:94734170-94734192 TGTAATATTGCCCATGGGGCTGG + Intergenic
1100702127 12:97160254-97160276 TGAAGTATTACCAATGAGGGAGG + Intergenic
1102307449 12:111816113-111816135 TGAACTCATTACCATGGGGGAGG - Intergenic
1104379605 12:128295555-128295577 TGAAAGCATACCCAGGGGAGGGG - Intronic
1105899320 13:24742257-24742279 TGAAATCTTACCCATGGGGGTGG + Intergenic
1109509006 13:63344161-63344183 TGAAATCTTAGCCATCTGTGAGG + Intergenic
1109561669 13:64057523-64057545 AGAAATCAGCCCCATGGGGGTGG + Intergenic
1111691754 13:91572615-91572637 TGAAATCATGACCATGGGGAGGG + Intronic
1118273303 14:64363313-64363335 TGCAATATTTCCCATGGGGGAGG + Intergenic
1122450357 14:101800987-101801009 TGTGATCTTACTCATGTGGGAGG + Intronic
1122776872 14:104121036-104121058 ACAAATCCTACCCATGAGGGTGG + Intergenic
1124710561 15:32006607-32006629 AGGAATCTTAACCATGGGGTAGG + Intergenic
1128295868 15:66518958-66518980 TCACATCTTACCCAAAGGGGAGG - Exonic
1128410923 15:67396239-67396261 TGCAATCTGACCCAGTGGGGAGG - Intronic
1130039792 15:80396784-80396806 TGAAATCTTTCCCATGGACTGGG + Intronic
1137860225 16:51839578-51839600 AGAAATCTTATCTATGTGGGGGG - Intergenic
1139501828 16:67372721-67372743 GGAAATCTTACACATTGGGGTGG + Intronic
1142529164 17:567166-567188 TATAATCTTACTCATTGGGGTGG - Intronic
1144581702 17:16462950-16462972 TGGAATCTTCCCGATGGGAGGGG + Intronic
1146087694 17:29845310-29845332 TGAAGCCTTAACCTTGGGGGTGG - Intronic
1146198580 17:30834732-30834754 TGAAAGCTTACCCTTGGCAGAGG + Exonic
1146340711 17:32017546-32017568 TGAAATCTCAGCAATTGGGGAGG + Intronic
1155464565 18:26120606-26120628 TGAGATCTTACCCAATGGGGAGG - Intergenic
1158732189 18:60036227-60036249 AGAAATCTTTACCTTGGGGGCGG + Intergenic
1160022210 18:75189801-75189823 AGCAAGCTTACCCATGGGGTGGG - Intergenic
1160102273 18:75934184-75934206 TGAGATGTTACCAATGGAGGAGG - Intergenic
1161371359 19:3913707-3913729 TGAAATGCAACCCATGGGGTGGG - Intronic
1167712995 19:51123918-51123940 TGAAATCCTGCCCATCGCGGAGG + Intergenic
926201096 2:10798444-10798466 TGTAATCTTAGCTATTGGGGAGG + Intronic
926815692 2:16796404-16796426 TGAAAACTTACCCATAGTGAAGG + Intergenic
928095284 2:28400967-28400989 TGACAGCTTCCCCATGGAGGAGG + Intronic
933071338 2:77862157-77862179 TGAAATATAACCTAAGGGGGAGG - Intergenic
934575904 2:95401518-95401540 TGAAATGGAACCTATGGGGGTGG - Intergenic
935323335 2:101909948-101909970 TGAAATCTAACCCAGGTAGGGGG - Intergenic
936603364 2:113922511-113922533 TGAAATCTTAGCGGTAGGGGCGG + Intronic
936958423 2:118047333-118047355 TGAAGGCCTACCCATGTGGGGGG + Intergenic
938694502 2:133823147-133823169 CCAAATCATACCCATGGGGCAGG + Intergenic
938869341 2:135457492-135457514 TTTAATCTTACCCATGAGGATGG - Intronic
939066999 2:137495513-137495535 TGAAATTTTACCCTTGGAAGTGG - Intronic
944777535 2:202982268-202982290 TGGAAGGTTACCCATGGTGGAGG - Exonic
945291388 2:208130954-208130976 AGAAATCTTACCCGTAGGGAGGG - Intergenic
945292071 2:208136600-208136622 AGGAATCTTACCCATGGGGAGGG - Intergenic
948621193 2:239235741-239235763 TAAAATGTTACCTATGGGGCTGG + Intronic
1168788334 20:558693-558715 TGTAATCTTACCTATTCGGGAGG - Intergenic
1170076872 20:12429201-12429223 TGTAATCTTAGCCCTTGGGGAGG + Intergenic
1173875197 20:46365988-46366010 TGAAATCTTCACCATTGGGCAGG + Intergenic
1176345372 21:5739285-5739307 TGAATTCTGACCCCTGAGGGAGG - Intergenic
1176352186 21:5859869-5859891 TGAATTCTGACCCCTGAGGGAGG - Intergenic
1176499455 21:7585170-7585192 TGAATTCTGACCCCTGAGGGAGG + Intergenic
1176539693 21:8137355-8137377 TGAATTCTGACCCCTGAGGGAGG - Intergenic
1176558644 21:8320400-8320422 TGAATTCTGACCCCTGAGGGAGG - Intergenic
1177737204 21:25106118-25106140 TGAAATGAGATCCATGGGGGTGG + Intergenic
1182321649 22:29481655-29481677 TTAAATCTTCCACGTGGGGGTGG + Intronic
1183249974 22:36723503-36723525 TGTAAGCTTAACCATGGGGTTGG - Intergenic
1203244642 22_KI270733v1_random:53710-53732 TGAATTCTGACCCCTGAGGGAGG - Intergenic
951363936 3:21757530-21757552 AGAAATCTTAACCTTGGAGGTGG + Intronic
952199854 3:31114804-31114826 TGAAATCTTAGCATTGTGGGAGG - Intergenic
954014731 3:47677662-47677684 TGTAATCTTAGCTATTGGGGAGG - Intronic
956221076 3:66903928-66903950 TGAAACCTTCCTCATGGGGCTGG - Intergenic
958113176 3:89177461-89177483 TGAAATCTTACCAATGGGAGAGG - Intronic
961258019 3:125573748-125573770 TGTAATCTCAGCCATGTGGGAGG + Intronic
961479856 3:127172711-127172733 TAAATTCTTACCCATGGGAGTGG + Intergenic
964866384 3:161266343-161266365 TGAGATGTTACCATTGGGGGAGG + Intergenic
966100832 3:176267493-176267515 GGAAATCTTGCCCAGTGGGGAGG - Intergenic
966305368 3:178527131-178527153 TGAAATCTTAACCATGCGTGTGG - Intronic
967813167 3:193777408-193777430 TGAAATCTTAACCCTAGGAGGGG + Intergenic
970904093 4:21194990-21195012 TGAGATCTAACCCATGGGTCAGG - Intronic
980425394 4:132620970-132620992 TGTAATCTTACCCCTTTGGGAGG - Intergenic
981152258 4:141392876-141392898 TGTAATCTTAGCTATGTGGGAGG - Intergenic
983812637 4:172082209-172082231 TGAAATATTAGCTATGGGGAAGG + Intronic
987272933 5:16330966-16330988 TGAAATCCTAACTATGGGGGAGG + Intergenic
987487360 5:18539567-18539589 TGGAATCTTACCCATAGTGAAGG - Intergenic
988042398 5:25906219-25906241 TGTATTCTTACACATGGAGGTGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990805776 5:59659926-59659948 TGCAATCTTACCACTTGGGGAGG + Intronic
991977410 5:72196744-72196766 AGACATCTCATCCATGGGGGTGG - Exonic
993732523 5:91439479-91439501 TGAAATCTTACTAGTGGCGGAGG - Intergenic
995404032 5:111773948-111773970 TGGGCTCTTACCCGTGGGGGAGG + Intronic
999694434 5:154176274-154176296 TGAACTCCTAACCATGGGGAGGG - Intronic
999963368 5:156781123-156781145 TGAAAATTTACCCTTGGAGGAGG + Intergenic
1001224652 5:169933343-169933365 TGAAATCATATCCTTAGGGGTGG - Intronic
1004131141 6:12921433-12921455 TGACATCCTACCCATGCTGGAGG + Intronic
1004791897 6:19035686-19035708 AGAAATCTTAGCCAAGGGGAAGG + Intergenic
1006949004 6:37805957-37805979 TGATTTATTACCCATGGGGTGGG - Intergenic
1010266905 6:73877888-73877910 TGAAATCTGCCCCCTGGGGAAGG + Intergenic
1010827061 6:80486887-80486909 TGGAATCTTACCCATAGTGAAGG + Intergenic
1011347011 6:86381313-86381335 AAAATTCTTACCCATGGGGCTGG + Intergenic
1012248921 6:96958739-96958761 TGAATTCTTTCCAATGGGTGGGG - Intronic
1014201226 6:118610774-118610796 TGACAACTTATCAATGGGGGAGG + Intronic
1020414200 7:7927466-7927488 TGAACTCATATCCATTGGGGTGG - Intronic
1021945755 7:25725519-25725541 TGAAAACTCACCCATGTAGGAGG + Intergenic
1030232903 7:107226536-107226558 AGAAAGCTTACCCATGTGGCGGG - Intronic
1032127760 7:129206964-129206986 TGTAATTTTAGCTATGGGGGAGG - Intronic
1037930810 8:22879041-22879063 TAAAATGTTTCCCATGGGGAAGG - Intronic
1038462270 8:27727269-27727291 TGAAATCTTAAAAATGTGGGCGG - Intergenic
1041962777 8:63637917-63637939 TGAACTCTTTCCCATGTGTGTGG - Intergenic
1042361719 8:67891336-67891358 TGTAATCATAACCTTGGGGGAGG + Intergenic
1042958792 8:74280363-74280385 TGAGTTCTTACCCATGAGGATGG - Intronic
1044563222 8:93634391-93634413 TGAAATCTAAATCATGGGGTTGG + Intergenic
1045474803 8:102543546-102543568 TGAACCCCTACCCATGGGGAAGG - Intergenic
1047218663 8:122900487-122900509 TGAAATCTGATCCCTGGGGTTGG - Intronic
1053600642 9:39605230-39605252 TGCAATCTGACCCATGCAGGTGG + Intergenic
1054252887 9:62737199-62737221 TGCAATCTGACCCATGCAGGTGG - Intergenic
1054567004 9:66771698-66771720 TGCAATCTGACCCATGCAGGTGG - Intergenic
1054772376 9:69094917-69094939 TGTAATCTTACCTATCTGGGAGG - Intronic
1203460976 Un_GL000220v1:36793-36815 TGAATTCTGACCCCTGAGGGAGG - Intergenic
1190119242 X:47647021-47647043 TGAAATCTTAGGCATAGGGAAGG - Intronic
1190209266 X:48431895-48431917 TGAAATCTCAGCCATGTGGGAGG - Intergenic
1192126947 X:68509965-68509987 TGAATTCTTACCCATCTGTGTGG + Intronic
1193218850 X:78898829-78898851 GGATATCTTATCCATGGGTGGGG - Intergenic
1196470307 X:116016486-116016508 TGAACTCATAACCATGGGGAGGG + Intergenic
1199878659 X:151955243-151955265 TGGAATGTTACCCAGGGTGGTGG - Intronic
1200888891 Y:8300240-8300262 AGAAAACTTACCTATGGGAGAGG - Intergenic