ID: 1105899394

View in Genome Browser
Species Human (GRCh38)
Location 13:24742541-24742563
Sequence TTCAAGAAGCAGCAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 3, 2: 3, 3: 46, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105899394 Original CRISPR TTCAAGAAGCAGCAAGAGGG AGG (reversed) Intergenic
900926487 1:5709420-5709442 GGCAAGAAGCAGCAAGAGAAGGG - Intergenic
901335408 1:8444758-8444780 TGGAAGAAGGAGCAAGGGGGTGG - Intronic
902183186 1:14705148-14705170 GGGAAGAGGCAGCAAGAGGGAGG - Intronic
902587056 1:17446190-17446212 TTCAAAAGGCAGCAGGAGGCCGG - Intergenic
902852696 1:19173043-19173065 TTCATGCAGCTGCAAGATGGTGG + Exonic
903157680 1:21459263-21459285 TTGAAGAAGCAGTAAGTTGGAGG + Intronic
904216159 1:28921578-28921600 GGCAAGAAACAGCAAGTGGGTGG - Intronic
904356149 1:29941278-29941300 TTCATGAGCCAGGAAGAGGGAGG + Intergenic
906035463 1:42747873-42747895 CTCAACCAGCAGCAGGAGGGTGG + Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906815738 1:48876408-48876430 ATCAAGAGGCAGCGAGAGGAAGG + Intronic
907226790 1:52955214-52955236 TTGAAGAACTAGCAAGAGAGAGG + Intronic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
907865112 1:58391737-58391759 TGCAGGAAGCAGTAAGAGGGTGG - Intronic
908710497 1:67008902-67008924 TTTAAGAAGCAGGGAGAGGTTGG - Intronic
908838215 1:68249995-68250017 GTGAAGAGACAGCAAGAGGGTGG - Intergenic
911853185 1:102844001-102844023 TCCAAGAAGCAGCAAGAGAATGG + Intergenic
912113417 1:106372493-106372515 TTCAAGCAGATGCAAGAGGTGGG + Intergenic
912164779 1:107030202-107030224 TGAAAGCGGCAGCAAGAGGGTGG - Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
916516997 1:165527714-165527736 ATCAGGGAGCACCAAGAGGGTGG - Intergenic
918025171 1:180736945-180736967 CTCAAGCAGCCGCAAGATGGTGG + Intronic
918087311 1:181256641-181256663 TTCAAGGAACAGCAACAAGGCGG + Intergenic
918914102 1:190612847-190612869 TTCAAGAAGATTCAAGAGTGAGG + Intergenic
919077456 1:192830864-192830886 TTCATGAAGAAGGAAGAGTGTGG - Intergenic
919657126 1:200208163-200208185 GTGAAGAAGCAGCAAGAAGGCGG + Intergenic
920642371 1:207764903-207764925 TTCAAGAAAGTGCAAGAGGAGGG + Intronic
921924515 1:220700205-220700227 ACCAAGAAGCAGCCAGAGGCAGG + Intergenic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922621053 1:226988424-226988446 GTCAAGCAGCAGCATGCGGGGGG + Intergenic
923272903 1:232373475-232373497 TCCCTGAAGCAGCAAGATGGGGG - Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
1063955003 10:11257539-11257561 TTCAGGAAGCACCAGGTGGGAGG + Intronic
1064074800 10:12260122-12260144 TCCAGGACACAGCAAGAGGGTGG + Intergenic
1064281647 10:13956796-13956818 TTCATAAAACAGCAAGAGGTTGG + Intronic
1064923603 10:20545697-20545719 TCCAAGTACCAGCAAGAGGTTGG + Intergenic
1066950431 10:42111756-42111778 GACAAAAAGCAGCAAGAGCGGGG + Intergenic
1067875650 10:50005313-50005335 TTAAAGAAGCAATAAGAGGCTGG + Intronic
1069582504 10:69575236-69575258 CTCAGGAACCAGCGAGAGGGGGG + Intergenic
1070346857 10:75552428-75552450 TTCTGAAAGCAGCCAGAGGGGGG - Intronic
1070556521 10:77532129-77532151 TACGAGAAGCAGCAACTGGGGGG + Intronic
1071187486 10:83060973-83060995 TTTAAGACACAGAAAGAGGGTGG - Intergenic
1071490409 10:86132320-86132342 TTCAAGAGGCAGCCAGAACGCGG - Intronic
1071607281 10:87004953-87004975 TTAAAGAAGCAATAAGAGGCTGG + Intergenic
1071767993 10:88690439-88690461 TTGAAAATGCAGCCAGAGGGTGG + Intergenic
1072056307 10:91760567-91760589 TTCTAAAAGCAGCAAGAGAGAGG + Intergenic
1072649028 10:97279017-97279039 TTGAAAAAGCAGTAAGAGAGAGG - Intronic
1073169391 10:101490693-101490715 TTATACAAGCAGCAAGAGGTAGG - Intronic
1073522156 10:104142753-104142775 GTCAAGAAGCAACAAGAGGAAGG + Intronic
1073582426 10:104680859-104680881 CTCAAGCACCAGCAAGAAGGAGG + Intronic
1073660422 10:105470067-105470089 TTCAAGAGACAGCAAAAGGAAGG - Intergenic
1073758723 10:106608063-106608085 TTCTAGAAGCATCTAGAGAGAGG - Intronic
1073842031 10:107508773-107508795 TTCAGGCAGCAGGAAGAGAGTGG - Intergenic
1074559069 10:114519115-114519137 TTCAAGAGGCAGCCTGGGGGAGG + Intronic
1075456259 10:122586926-122586948 AGCAAGAAAGAGCAAGAGGGAGG + Intronic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1077522811 11:3046332-3046354 TCCAAGACACAGCCAGAGGGGGG - Intronic
1077730588 11:4725080-4725102 CTGAAGAAGGAGCAAGGGGGAGG - Intronic
1078727438 11:13944124-13944146 TTCCAAAAGCAGCAAGACAGAGG - Intergenic
1078777874 11:14410368-14410390 TTCAAGAAATAGCAAGATGATGG + Intergenic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079505890 11:21151337-21151359 TTCATAAAGCAGCATGAAGGTGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1085468228 11:76738662-76738684 AACAAGAAGCAGAAAGAGAGGGG + Intergenic
1087787066 11:102366924-102366946 ATCAAGAAACAGAAAGAAGGTGG - Intronic
1087974310 11:104525539-104525561 TGGAAAAGGCAGCAAGAGGGTGG + Intergenic
1089085428 11:115813097-115813119 TTCAGGAAGCAGCAAAAGGTTGG - Intergenic
1089214964 11:116829766-116829788 GTCCAGATGCAGCAAGCGGGCGG - Intronic
1089430150 11:118416864-118416886 TACAAGAAGCATCAACAGGAGGG + Intronic
1090111074 11:123910218-123910240 TTGAAGGTGGAGCAAGAGGGTGG + Intergenic
1090788315 11:130069438-130069460 TTCCAGAATCAAAAAGAGGGCGG + Intergenic
1091385383 12:91460-91482 TTAAAGAACCAGGAAGATGGGGG - Intronic
1092240108 12:6830998-6831020 TTCAAAGAAGAGCAAGAGGGGGG - Intronic
1092409066 12:8240405-8240427 TACAAAAATCTGCAAGAGGGGGG - Intergenic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1092757687 12:11778904-11778926 TTCAAGAAGCTACAATAAGGGGG - Intronic
1093666035 12:21814323-21814345 TTCAAGAGAAAGAAAGAGGGAGG - Intronic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096638941 12:52978950-52978972 TTCAAGAAGGAGGGAGAGGCTGG - Intergenic
1098655224 12:73019715-73019737 GGCAAGAAGGAGCAAGAGAGTGG - Intergenic
1099904997 12:88761203-88761225 TTCACAAGGCAGCAAGAGAGAGG + Intergenic
1100586906 12:95988939-95988961 TTCAAGTATCAGCTAGAGGCTGG + Intronic
1100616380 12:96234772-96234794 CTCAAGATGCAGCAGCAGGGCGG + Intronic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101929974 12:109005942-109005964 TTCAAGTAGCAGCAAGAGGGTGG + Intronic
1102220401 12:111190550-111190572 GTCAAAAAGCATCAAGAGGTGGG - Intronic
1102542251 12:113629792-113629814 TTCAAAAAGCTCCAAGTGGGTGG + Intergenic
1102901975 12:116646082-116646104 TTCAGGCGGCAGCAACAGGGAGG + Intergenic
1103159856 12:118720075-118720097 TAAAAGTAGGAGCAAGAGGGAGG - Intergenic
1103520788 12:121536178-121536200 TGCAAAAGGCAGCCAGAGGGAGG - Intronic
1104083999 12:125458037-125458059 TTGAAGAAGGAGGCAGAGGGTGG + Intronic
1104505379 12:129327195-129327217 TTCAAGCAGAAGCCAGTGGGCGG + Intronic
1104825356 12:131704173-131704195 TTCTAAAAACATCAAGAGGGTGG + Intergenic
1104901548 12:132191980-132192002 TACAGGAAGCAGCATGCGGGGGG - Intergenic
1105743882 13:23358402-23358424 TTCAAGAAATAGCAAGAAGCAGG - Exonic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106215161 13:27690632-27690654 TTCCAGGAGTAGAAAGAGGGTGG - Intergenic
1108372938 13:49788942-49788964 TTGAAGGAGGAGGAAGAGGGAGG + Intronic
1109075168 13:57824668-57824690 TTATATAAGAAGCAAGAGGGAGG - Intergenic
1109332390 13:60945589-60945611 TCCAAGAAACAGCAAGAAGGTGG + Intergenic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1115266544 14:31506579-31506601 ATAAAGAGGCAGTAAGAGGGAGG - Intronic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116811835 14:49546794-49546816 TTTAAGAATCAGCAAGTTGGTGG - Intergenic
1117704870 14:58454772-58454794 GTGAAGAGACAGCAAGAGGGAGG - Intronic
1117978162 14:61318753-61318775 TGGAAGAAGCAGCACGAGTGTGG - Intronic
1118085874 14:62416427-62416449 TTAAAGAGGTAGTAAGAGGGAGG + Intergenic
1119328273 14:73775154-73775176 GTCCAGGAGCAGCAAGAGGCCGG + Intronic
1119536400 14:75406313-75406335 ATAAGGAAGCAGCCAGAGGGAGG - Intergenic
1119543752 14:75457279-75457301 TTCAAGAAGCACCAGGAAGGAGG + Intronic
1120823481 14:88934235-88934257 TTTGAGAAGCAGCAAGCGGTGGG - Intergenic
1121154413 14:91669374-91669396 CTGAAGGAGCAGCCAGAGGGTGG + Intronic
1121749296 14:96335130-96335152 TTCAGGAATCATCAAGAGAGTGG - Intronic
1122410528 14:101523485-101523507 TTCATGCAGCTGCAAGTGGGGGG + Intergenic
1122418618 14:101561872-101561894 TTCAAGCAGGCGCACGAGGGCGG + Exonic
1122964632 14:105116671-105116693 TTCAAGAAGCTGGAAGTGGCCGG - Intergenic
1123830968 15:24136735-24136757 TTAAATAACAAGCAAGAGGGTGG + Intergenic
1125869874 15:43090068-43090090 TACAGGAAACAGAAAGAGGGAGG + Intronic
1126176657 15:45742251-45742273 GTGAAGAGGCAGCGAGAGGGAGG + Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1127349649 15:58137757-58137779 TCCAAGAATCAGAAAGATGGAGG - Intronic
1127363762 15:58267879-58267901 GTGAAGAGGCAGCAATAGGGCGG - Intronic
1127806763 15:62528376-62528398 TACAAGGAGAAGCAAGAGGAAGG + Intronic
1127834097 15:62776055-62776077 CTCAAGTAGCAGCAAGATGCAGG - Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128317872 15:66672445-66672467 GTGAAGAGGCAGCAAGAGAGTGG - Intronic
1128400148 15:67270629-67270651 TGAGAGAAGCAGCAAGAGAGAGG - Intronic
1128611189 15:69074705-69074727 TTGAAGCATTAGCAAGAGGGTGG - Intergenic
1128775734 15:70318693-70318715 TTTGGGAAGCAACAAGAGGGAGG + Intergenic
1129176374 15:73842456-73842478 GAAAAGAGGCAGCAAGAGGGCGG + Intergenic
1130103892 15:80914665-80914687 TTCAAGAAACTGAAAGAGGGAGG - Intronic
1131656950 15:94470898-94470920 ATCCAGAAGCAGGGAGAGGGAGG + Intronic
1132850247 16:2021780-2021802 TTGAAGAGGCAGCGGGAGGGAGG - Intergenic
1134915147 16:18063016-18063038 TTCAAGCAGCAGAAAGAAAGAGG - Intergenic
1135043584 16:19136332-19136354 TTCAGGAAACACCAGGAGGGAGG - Intronic
1136022271 16:27447807-27447829 TTCAAGAAGCATCAAGGAGGCGG + Intronic
1136368657 16:29821903-29821925 TGCAAAAAGCAGCAGGAGTGGGG + Intronic
1136566581 16:31073973-31073995 TTCAAGAACCAGAAGGTGGGAGG + Intronic
1136679390 16:31947390-31947412 TTTAAAAAGCAGCAAGAGAAAGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137410845 16:48226936-48226958 CTCATGAAGCAGCTAGAGGTAGG + Intronic
1140135978 16:72205858-72205880 TTCTAGAAGCATCTAGATGGAGG + Intergenic
1140963623 16:79942304-79942326 ATGAAGAGGCAGCAAGGGGGTGG - Intergenic
1141752492 16:85968211-85968233 TGCAAGTAGCAGCACGAGAGAGG - Intergenic
1142571497 17:877842-877864 TCCAAGAAACAGCAAGAGGCAGG + Intronic
1142858647 17:2748240-2748262 TTCAAGAGGCAGAGATAGGGTGG - Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1144725592 17:17500451-17500473 TTCAAGAAGAAGCAGGAGGGAGG - Intergenic
1145998070 17:29115729-29115751 TTCAAGCACCAGCACAAGGGTGG - Exonic
1146466304 17:33089370-33089392 TTCTAGAAGCAGGAAAAGGCAGG + Intronic
1146753741 17:35407744-35407766 TACAAGGAGCAGCGGGAGGGCGG - Intergenic
1147052934 17:37810479-37810501 TTCAGGAAGAGGCAAGAGGTAGG + Intergenic
1147132309 17:38416694-38416716 TTCCAGAGGCTTCAAGAGGGAGG - Intergenic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1151421574 17:74001521-74001543 TCCAATAACCAGCCAGAGGGAGG + Intergenic
1151626192 17:75277387-75277409 TTCAAGAAGCGGCTACAGGTTGG - Exonic
1152010421 17:77709816-77709838 TCCAAGGAGCAGCAGGAGAGAGG + Intergenic
1153557074 18:6326113-6326135 GTCAAGAAGGAGTAAGATGGAGG - Intronic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1154464294 18:14629282-14629304 TTCCAGAAGAAGAAGGAGGGAGG - Intergenic
1155099584 18:22596145-22596167 GGCAAGAAGCAGCAAGAAGTGGG - Intergenic
1155345383 18:24852464-24852486 TTCAAGAAGGAACTAGAGGCTGG + Intergenic
1156399755 18:36729590-36729612 TTGAAGACACAGCAAGAAGGTGG - Intronic
1156991644 18:43415857-43415879 TTCAAAGAGCAGCAAGGGGTGGG - Intergenic
1157237917 18:45981471-45981493 GTGAAGAGGCAGCAAGAGAGTGG - Intergenic
1157675050 18:49562457-49562479 TTGAAGAATCAGCAAGACAGAGG - Intronic
1158419284 18:57278626-57278648 TTCAAGAAGAAGGAAGAGTCAGG + Intergenic
1158625511 18:59068062-59068084 ATCAAGATGCAGCCACAGGGGGG - Intergenic
1158751293 18:60264267-60264289 GTGAGGAGGCAGCAAGAGGGCGG - Intergenic
1160573241 18:79832556-79832578 TTCAAAAAACAGCAAGAGAGTGG - Intergenic
1160972261 19:1774860-1774882 TCCAGGATGCAGCCAGAGGGCGG - Intronic
1161216447 19:3097147-3097169 TTCAGGGAGCAGCTAGAGGGTGG + Intronic
1162393045 19:10401255-10401277 AGAAAGAAGCAGCAAGAGGTGGG + Intronic
1162876549 19:13624904-13624926 TATAAGAAGCATCAAGAGGCCGG + Intergenic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1164107773 19:22124065-22124087 CTCAAAAAGCAACAAGAGGCCGG - Intergenic
1164436576 19:28235794-28235816 TTGAAGAAGAAGTAAGTGGGTGG + Intergenic
1166368855 19:42290674-42290696 AACAAGGAGGAGCAAGAGGGCGG + Exonic
1166551397 19:43668459-43668481 CTCAAGGAGGAGCTAGAGGGAGG - Intronic
1166627745 19:44374734-44374756 ATCAAGATGTAGCAAGAAGGAGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167072244 19:47227987-47228009 TGCAAGAAGCAGGAAGACGGAGG - Intronic
1168086669 19:54052818-54052840 TTCCAAAAGCAGCCAGAGGCCGG + Intronic
1168320667 19:55507771-55507793 TTCAAGAAATAGCAACAAGGTGG + Intronic
1168503343 19:56912199-56912221 CTCTAGAAGCAGAAAGAAGGAGG - Intergenic
925601262 2:5610897-5610919 TTTAATAAGCAGCAAGAGAGAGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
927202090 2:20584187-20584209 TTCTAGAAGCAGCACCAGGAAGG - Intronic
927518251 2:23684606-23684628 TTCAGGAACCTGCAAGAGAGGGG - Intronic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
928785543 2:34881207-34881229 TTAAAGAAGGAGCAAAAGGAAGG - Intergenic
929610783 2:43269278-43269300 TTTCAGAAGCAGCAAGAGTCAGG + Intronic
931500274 2:62857055-62857077 TTCTAGAAGCTGGAAAAGGGAGG + Intronic
932238630 2:70140911-70140933 TTGTAGAAGCAGCAAGTGTGAGG + Intergenic
933479829 2:82841606-82841628 TACAAGAAGCAGCAACATGAAGG - Intergenic
934695348 2:96396176-96396198 TTCAAGGAGCACAATGAGGGGGG + Intergenic
934976693 2:98807808-98807830 TTCAAGAAGCTGATAGAGGGGGG + Intronic
935047544 2:99495603-99495625 TTTAAGAGTCAGCAAGAGGTAGG - Intergenic
935600916 2:104920465-104920487 TGCAAAAAGCAGCAAGAAGCAGG + Intergenic
935793736 2:106618892-106618914 GTCAGGAAGCAGAAAGAGGGAGG + Intergenic
936469238 2:112783846-112783868 TTCAGGAAGCACAAAGAGGAGGG - Intronic
936741536 2:115517146-115517168 TTCAGGAAACAGGAACAGGGAGG + Intronic
938545767 2:132329845-132329867 ATCAAGATGTAGCAAGAAGGAGG + Intergenic
939954627 2:148517282-148517304 GTTAAGAAGCAGTAAGAGGCTGG - Intronic
940345890 2:152628114-152628136 GTCAAGAACCAGCACCAGGGTGG + Intronic
940418579 2:153451862-153451884 CTCATGAAGCAGCTAGATGGGGG + Intergenic
941089829 2:161161167-161161189 TTCTAGAAGTAGAAAGGGGGAGG + Intronic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942447443 2:176087550-176087572 ATCAAAAAGCATCAACAGGGAGG - Intergenic
942570681 2:177311037-177311059 TTCACAAGGCAGCAGGAGGGAGG + Intronic
942596866 2:177599815-177599837 GTCAGGGAGCAGCAAGAGGCTGG - Intergenic
943458252 2:188135559-188135581 TTAATGCAGCAGCAAGAGGAGGG - Intergenic
946076911 2:217081821-217081843 ATCAAGAAGGAGCAAGAGACGGG + Intergenic
946345990 2:219110803-219110825 TTCAAGAAACAGGAAGGAGGCGG + Intronic
946508893 2:220333292-220333314 TTCTAAAAGCAGCAAGAGAAAGG - Intergenic
946699336 2:222395900-222395922 ATGAAGAGGTAGCAAGAGGGTGG - Intergenic
948447848 2:238046849-238046871 TTCCAGAAGCACCAAGGGTGTGG + Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1168797711 20:622560-622582 TTCAAGGAGTAGCAAGGAGGTGG - Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1169516551 20:6322237-6322259 TTAAAGAAGCAACAACAGGCTGG - Intergenic
1171148978 20:22810315-22810337 TTCAAGAAGGGGCAGGAGGGCGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171874628 20:30562599-30562621 ATCAAGATGTAGCAAGAAGGAGG + Intergenic
1172911234 20:38410761-38410783 TGCCAGGAGCAGCAGGAGGGTGG - Intergenic
1173182827 20:40817554-40817576 TTCTAGAAGCAGCCAGATGCTGG - Intergenic
1174266028 20:49332861-49332883 TTCAAGGATCAGCAAGAAGGCGG + Intergenic
1174513826 20:51076032-51076054 TTCCAGATGGAGAAAGAGGGTGG + Intergenic
1175140850 20:56859479-56859501 TGCAAGAAGGAGCAAAGGGGAGG - Intergenic
1175482498 20:59321396-59321418 TCCAAAAGGCAGCAAGGGGGTGG - Intronic
1175927744 20:62479337-62479359 TTCAGGAAGCAGCATGGGCGGGG - Intergenic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1177707031 21:24719868-24719890 GTAAAGATGCAGCAAGAAGGGGG - Intergenic
1178354597 21:31900069-31900091 ATCAAAAAGCAGCCAGAGGCTGG - Intronic
1178605201 21:34030155-34030177 TTACAGAAGAAGCGAGAGGGTGG + Intergenic
1178683034 21:34689178-34689200 TTCCAGATGCAGGGAGAGGGTGG + Intronic
1178880030 21:36442046-36442068 TTCACGAAGCAGCCAAAGAGAGG + Intergenic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1181045108 22:20210677-20210699 CTCACAAAGCAGCAAGGGGGAGG - Intergenic
1183580530 22:38723396-38723418 TTCCAGAAGCAGCAAGCTTGAGG + Intronic
1185380481 22:50505494-50505516 TTCCAGCAGCAGCGACAGGGTGG + Exonic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950198831 3:11028573-11028595 TTCCAGGTGCAGAAAGAGGGTGG - Intronic
950933893 3:16819217-16819239 TTCAGGAAGAAGCATGAGGGAGG - Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
951913763 3:27777926-27777948 GTCAGGAAGCAGAAGGAGGGAGG + Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
952773531 3:37023025-37023047 TCTAAGAAGCAGAAAGATGGTGG - Intronic
952872395 3:37912348-37912370 TTTCAAAAGCAGCAAGAGGCTGG - Intronic
953244663 3:41179672-41179694 TCCAAGAAGGAGAAAGATGGAGG - Intergenic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
955864542 3:63369191-63369213 GTGAAGAGGCAACAAGAGGGTGG + Intronic
955994406 3:64664870-64664892 TTCAAGAAGAAGCAAGAAAATGG - Intronic
956287386 3:67625401-67625423 ATCAAGAAGCAACACCAGGGAGG + Intronic
957656952 3:83092602-83092624 GTGAAGAAGTAGCAAGAAGGTGG + Intergenic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
958932028 3:100217458-100217480 TCCAAGAAGTAGGAGGAGGGTGG + Intergenic
959499793 3:107092972-107092994 TTCATGGAGCAGCAAGGGGGAGG + Intergenic
959882483 3:111460665-111460687 GTAAATAAGCAGCAAGAGGGTGG + Intronic
960763600 3:121099428-121099450 TTCAAGAAGCTACAATAGAGGGG + Intronic
960790465 3:121424879-121424901 TTCAAAAAGCAGGGAGGGGGTGG + Intergenic
961360519 3:126364505-126364527 TTCTTGAAGGAGCAGGAGGGAGG - Intergenic
961893516 3:130149260-130149282 TTCAAGGAACAGAAAGAGGGTGG + Intergenic
962149419 3:132877205-132877227 TTGATGAAGCAGAAAGTGGGAGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967159752 3:186725217-186725239 TTCATTAAGCATGAAGAGGGAGG - Exonic
968566811 4:1317416-1317438 GACAAGAGCCAGCAAGAGGGTGG - Intronic
969648675 4:8449383-8449405 TGCATGAAGCAGCAGGAGAGAGG + Intronic
969756873 4:9155801-9155823 TACAAAAATCTGCAAGAGGGGGG + Intergenic
969849881 4:9947872-9947894 GTCAGGAGGCAGAAAGAGGGAGG - Intronic
970258174 4:14191673-14191695 TTCAAGAAGCAGAGAGAATGTGG - Intergenic
970543040 4:17098454-17098476 TTCAAGGTGCAGCAAGGAGGAGG + Intergenic
971373062 4:26033752-26033774 TTCTAAAAGCAGCAAGAGAGAGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971583213 4:28369772-28369794 TTCAAGACCCAGCAACTGGGTGG + Intronic
971615651 4:28787925-28787947 TACAGGAAGCAGGGAGAGGGTGG + Intergenic
972136988 4:35904661-35904683 TCCAAGATGGAGCAAGATGGAGG - Intergenic
973330958 4:48909912-48909934 TTCAAGAATGAGTAAGAGAGAGG - Intergenic
973919607 4:55671897-55671919 TTCTAAAAGCAGCAAGAGAAAGG - Intergenic
975565126 4:75746127-75746149 TTCAAACTACAGCAAGAGGGAGG - Intronic
976036964 4:80835342-80835364 TTCAAGAAGCAGGCCGAGGCGGG - Intronic
976202087 4:82589082-82589104 TTCAGGCAACAGCAAGAGTGAGG + Intergenic
976687862 4:87835860-87835882 TCCAAGAAGCAGCTGGAGTGGGG + Intronic
978706469 4:111718793-111718815 TTCTAGACACAGCCAGAGGGGGG + Intergenic
981357029 4:143800562-143800584 TTCAAAGAGCAGCATGAGTGAGG + Intergenic
982323666 4:154107284-154107306 TTCAAGAAACAAAAAGAGAGGGG + Intergenic
982971358 4:161992019-161992041 TTCAAGAAGCATCAAGGAGGCGG + Intronic
983997912 4:174207797-174207819 TTTAGGAAGCAGCAACAAGGTGG - Intergenic
985843485 5:2327154-2327176 TTCAGTCAGCAGCAGGAGGGTGG + Intergenic
986642840 5:9889124-9889146 TTTAATAAGCAGCACCAGGGAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987353479 5:17041937-17041959 TTCCAGAAGCACCAAGAGATAGG + Intergenic
988095046 5:26596044-26596066 TGCCAGAAGAAGCAAGAGGAAGG - Intergenic
988445958 5:31286509-31286531 TTCAAGAAACTGCAAGAAGTAGG + Intronic
988483317 5:31647501-31647523 TCCCAGAAGCTGCAAGAGGCAGG - Intronic
988793790 5:34633695-34633717 ATAAAGAGGCAGCAAGACGGTGG - Intergenic
990642451 5:57802655-57802677 TTCAAGAAGAACCAAGAGTGTGG - Intergenic
991474994 5:67009990-67010012 TCCAGGAACCAGGAAGAGGGAGG + Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992300683 5:75376338-75376360 ATCATAAAGCATCAAGAGGGAGG + Intronic
992546280 5:77817089-77817111 ATCTAAAATCAGCAAGAGGGTGG + Intronic
992554150 5:77886785-77886807 TACAAGAAGCAGTGAGAGGTGGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993447215 5:88027938-88027960 ATCTAGAAACAGCTAGAGGGTGG + Intergenic
994159774 5:96544004-96544026 TTGAAGAAGAAGCAAGGTGGAGG - Intronic
994730630 5:103486764-103486786 TTCTAGAAGCATCAAGAAGTAGG - Intergenic
996409440 5:123142127-123142149 TTCAATACCCAGTAAGAGGGAGG - Intronic
997291433 5:132738534-132738556 GTGCAGAAGAAGCAAGAGGGAGG - Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997973260 5:138421943-138421965 TTCAAAGAACAGCAAGAAGGTGG - Intronic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
1000058759 5:157633950-157633972 TGCAAGAAGAAGGAAGAGGAAGG + Intronic
1000254105 5:159521392-159521414 TTCAAGAAGTATAAAAAGGGAGG - Intergenic
1001171839 5:169426885-169426907 CGAAAGAAGAAGCAAGAGGGTGG + Intergenic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1003700546 6:8459951-8459973 ATCAAGAAGTAGAAAGAGGCTGG - Intergenic
1004404715 6:15322236-15322258 TTCAAGGAGCAGTAAGAGTGAGG + Intronic
1005085970 6:22006924-22006946 GTCAAGAGGCAGTAAGAGGGTGG + Intergenic
1005385751 6:25282428-25282450 TTCAAGGAACAGCAAGGAGGTGG - Intronic
1005591833 6:27336876-27336898 TTAAAGAGGCAGAAAAAGGGAGG - Intergenic
1006670971 6:35729378-35729400 TTCAAGCATCAGGAAGAAGGTGG - Intergenic
1007391438 6:41551735-41551757 CTCAAGTAGCAGCAAAGGGGTGG + Intronic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1011000454 6:82582699-82582721 GTAAAGAAGCAGCAGGAAGGTGG + Intergenic
1011046296 6:83087046-83087068 TTCAGAACACAGCAAGAGGGAGG + Intronic
1011115142 6:83881471-83881493 TACAAGAAGCAGTATGAGGCTGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011533065 6:88346045-88346067 TGAAAGCAGGAGCAAGAGGGGGG + Intergenic
1013017921 6:106177981-106178003 TTCAACCAGCTGCAAGAGAGGGG + Intergenic
1013961210 6:115902619-115902641 TGCAAGTAGCAGACAGAGGGTGG + Intergenic
1017066844 6:150537013-150537035 TTCAAAGAGGAGCAAGTGGGAGG + Intergenic
1017790954 6:157799079-157799101 TTCACAAGGCAGCAGGAGGGAGG + Intronic
1017898561 6:158701853-158701875 CACTAGAAGCAGGAAGAGGGAGG - Intronic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1019209991 6:170397310-170397332 TTCAAGCAGCAGAGAGAGTGAGG - Intronic
1019328820 7:452816-452838 ATCAAGGGTCAGCAAGAGGGAGG + Intergenic
1019739536 7:2665842-2665864 TTCCAGAAGCAGCATGGAGGCGG + Intergenic
1019769580 7:2875281-2875303 TTCCAGAAGCAGGAAGAGACAGG - Intergenic
1020004489 7:4775128-4775150 TTCAAGCAGCAGGAACAGCGCGG + Intronic
1021789886 7:24194275-24194297 TAAGAGAAGGAGCAAGAGGGAGG + Intergenic
1022231903 7:28422409-28422431 TTCTAGAAGCAGTAAGAAGGAGG + Intronic
1022319632 7:29276696-29276718 TCCAGGAAGCAGCTAGTGGGAGG - Intronic
1022602946 7:31778940-31778962 GTTAAGAAGCAGCAAGAGTCAGG - Intronic
1023128486 7:36978546-36978568 TTCAAGAAGAAGAAAGAGTTGGG + Intronic
1023214432 7:37847082-37847104 TTCCAGATGCTGCAAGTGGGAGG + Intronic
1023944353 7:44792043-44792065 TTCAAATAGTAGCGAGAGGGAGG + Intergenic
1024368869 7:48557599-48557621 TTCTAAAAGCAGCAAGAGAAAGG - Intronic
1025932652 7:66009016-66009038 TTCAGGAAACAGCTAGAGAGGGG + Intergenic
1026400442 7:70006553-70006575 TGCAAGAAGTAGCAAGATGTTGG - Intronic
1027602807 7:80260252-80260274 TTCATGGAGCAGTAAGAGGCTGG + Intergenic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1028752976 7:94403093-94403115 CTCAAGAAGAAGCAAGGGGGCGG + Intronic
1029206270 7:98870892-98870914 ATCAAGAAGGGGCAAGAGGCTGG - Intergenic
1030692391 7:112548973-112548995 TTCAGAAAGCAGCAAGAGCAAGG - Intergenic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1035743909 8:1947795-1947817 TTCGAGCAGCAGCAGTAGGGAGG - Intronic
1036591766 8:10174676-10174698 TGAAAGATGGAGCAAGAGGGCGG - Intronic
1037308610 8:17531201-17531223 ATAAAGAAGCAGCAAGAGCGGGG + Intronic
1037624208 8:20593344-20593366 TTCAAGAAGAAGGGAGAGAGAGG + Intergenic
1038416737 8:27402228-27402250 TTCACGAATGAGGAAGAGGGAGG + Intronic
1038692255 8:29774104-29774126 TTCAGGAAGCTGCCAGATGGTGG + Intergenic
1038959126 8:32499200-32499222 TTCAGGAAGCAGCATGCAGGTGG + Intronic
1039038220 8:33382804-33382826 TTCAGGAATCTGCTAGAGGGCGG - Intronic
1039287547 8:36058739-36058761 TTCAAGCAGCAGCAGTAGAGAGG - Intergenic
1040045117 8:42954958-42954980 TTCGAGAAGCAGGAACAGTGTGG + Intronic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1043104889 8:76095638-76095660 TTCTGAAAGCAGCAAGAGAGAGG - Intergenic
1043609651 8:82046211-82046233 TTGTAGAAGCAGGAAGAGAGTGG - Intergenic
1043743340 8:83842302-83842324 TGCAAGAAGCAGCAAGTGTCAGG + Intergenic
1043934768 8:86130739-86130761 TTCAAGTAGCAGCAGGAAGGAGG - Intronic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1044365593 8:91341798-91341820 TTCAAGAAGAAGCAAGGTGGTGG - Intronic
1045047079 8:98289493-98289515 AGCAAGAAGAAGGAAGAGGGAGG - Intronic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1047855798 8:128910358-128910380 TTTTAAAAGCAGCAAGAGAGAGG + Intergenic
1047906073 8:129474476-129474498 TTCAGGGAGCAGCAAGGAGGCGG - Intergenic
1048458889 8:134603281-134603303 TTCAAGAAAAGGAAAGAGGGAGG + Intronic
1048908032 8:139107201-139107223 GTCAAGAACCAGGAAGAAGGGGG - Intergenic
1049101864 8:140585629-140585651 TTTAAGCAGCAGCAAGGGAGGGG - Intronic
1050262476 9:3854995-3855017 TTCAGGCATCAGCAAGAGGCAGG + Intronic
1051385396 9:16502554-16502576 CCCAAGAAGAAGTAAGAGGGGGG - Intronic
1052129474 9:24824838-24824860 TTCAAGTAACAGCAAGAGAAAGG - Intergenic
1052240018 9:26260430-26260452 TTTAGAAAGCAGGAAGAGGGAGG + Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1055238851 9:74159309-74159331 GTCAAAAAGGAGCAAGAGGAGGG + Intergenic
1055360212 9:75481577-75481599 CACAGGAAGCAGCCAGAGGGAGG + Intergenic
1055460905 9:76519391-76519413 TTCTAGAAACTGCATGAGGGAGG + Intergenic
1057601272 9:96459637-96459659 GTCAAGAAGCAGAAAGAGTTTGG - Intronic
1058342287 9:103913078-103913100 TTCTAGATGCAGCAATAGGAGGG - Intergenic
1058634736 9:107025395-107025417 TTCAATCAGCAGCAAGATGCAGG + Intergenic
1059349936 9:113657189-113657211 ATCAAGCAGCAGCAAGGGGTGGG - Intergenic
1060222859 9:121773647-121773669 TTCAGGAAGAAGCCAGGGGGAGG - Intronic
1062510385 9:136902200-136902222 TTCAAGGAGCAGGGAGTGGGGGG - Intronic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187834362 X:23416142-23416164 TCCAAGGAGCAGGAAGAGGTGGG - Intergenic
1188318789 X:28709653-28709675 TTCAAGCAGCAGCTTGAAGGTGG + Intronic
1189119399 X:38378130-38378152 TTCAAGAGACAACAAGAGGCCGG - Intronic
1190338623 X:49278857-49278879 TTCTAGAAGTAGATAGAGGGAGG - Intronic
1190792210 X:53711024-53711046 GTGAAGAGGCAGCAAGAGAGAGG + Intergenic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1197998775 X:132410037-132410059 CTCAAAAAGCAGCAAGCAGGGGG + Intronic
1198443941 X:136692427-136692449 TTCCAGAAGTAGCCAAAGGGAGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199084616 X:143614525-143614547 TACCAGGAGCAGGAAGAGGGAGG + Intergenic
1199101366 X:143804491-143804513 TTCATGAACAAGCAAGAAGGTGG + Intergenic
1199345867 X:146738673-146738695 TTCAATTAGCAGGAAGAAGGCGG - Intergenic
1199732804 X:150653277-150653299 TACAAGAAGCTGGAAGAGGCGGG - Intronic
1200080208 X:153572482-153572504 TGCAGGAAGTAGCAAGGGGGTGG + Intronic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic