ID: 1105900171

View in Genome Browser
Species Human (GRCh38)
Location 13:24746438-24746460
Sequence CACAGCAAGGACCAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 1, 2: 10, 3: 59, 4: 460}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105900171_1105900187 30 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900187 13:24746491-24746513 GGGCCGGCGGGCGTTGGCGAAGG 0: 1
1: 0
2: 0
3: 24
4: 194
1105900171_1105900184 18 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900184 13:24746479-24746501 GTTCTCCTTGAGGGGCCGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 103
1105900171_1105900182 14 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900182 13:24746475-24746497 CCGCGTTCTCCTTGAGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 90
1105900171_1105900178 8 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900178 13:24746469-24746491 ACGTCACCGCGTTCTCCTTGAGG 0: 1
1: 0
2: 0
3: 1
4: 26
1105900171_1105900183 17 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900183 13:24746478-24746500 CGTTCTCCTTGAGGGGCCGGCGG 0: 1
1: 0
2: 1
3: 1
4: 71
1105900171_1105900186 24 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900186 13:24746485-24746507 CTTGAGGGGCCGGCGGGCGTTGG 0: 1
1: 0
2: 7
3: 6
4: 123
1105900171_1105900180 10 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900180 13:24746471-24746493 GTCACCGCGTTCTCCTTGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 42
1105900171_1105900179 9 Left 1105900171 13:24746438-24746460 CCGTCCTCCTGGTCCTTGCTGTG 0: 1
1: 1
2: 10
3: 59
4: 460
Right 1105900179 13:24746470-24746492 CGTCACCGCGTTCTCCTTGAGGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105900171 Original CRISPR CACAGCAAGGACCAGGAGGA CGG (reversed) Intergenic
900605823 1:3523115-3523137 CACAGGCAGGACCGGGAGGGAGG + Intronic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900983272 1:6058730-6058752 ATCAGGAAGGAACAGGAGGAGGG + Intronic
901838214 1:11937677-11937699 CCCAGCAAGTGACAGGAGGAGGG + Intronic
901863370 1:12088758-12088780 AACAGGAAGGAGGAGGAGGAGGG + Intronic
902037743 1:13469914-13469936 CACAGCAGGGACCAAGGGGGTGG - Intergenic
902809222 1:18878881-18878903 CAAAGCAAGGCCCATGAGTAGGG - Intronic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903066171 1:20700931-20700953 CACAGCAAGGCCTGGGAGGCAGG - Intronic
903360664 1:22775044-22775066 AATAGCAAGGGGCAGGAGGAGGG - Intronic
903676540 1:25068053-25068075 GACAGGAAGAACCAGGAGGAGGG - Intergenic
904300148 1:29549014-29549036 CCCAGTGAGGACCAGGAGGAAGG - Intergenic
904300158 1:29549048-29549070 CCCAGTGAGAACCAGGAGGAGGG - Intergenic
904300166 1:29549083-29549105 CCCAGTGAGGACCAGGAAGAGGG - Intergenic
904428525 1:30447070-30447092 GACATCAGGGAACAGGAGGAGGG + Intergenic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
905167568 1:36091965-36091987 CACAGCCAGGGCCTGCAGGATGG - Exonic
905509593 1:38508323-38508345 CACAGCAAGCTTCTGGAGGAAGG - Intergenic
905733523 1:40311776-40311798 CAGAGGCAGGACCTGGAGGAGGG - Intronic
906800450 1:48732629-48732651 AACAGAAAGGACCTGGAAGAAGG + Intronic
906962918 1:50430347-50430369 CCCGGAAATGACCAGGAGGAGGG + Intergenic
907287284 1:53389986-53390008 CACAGCAGGAGCCAGGAGGATGG + Intergenic
907313347 1:53552348-53552370 CACAGCATGGCCCAGGTGGCAGG + Intronic
907461222 1:54606982-54607004 CTCAGCAAGGGCCAGCAGGAAGG - Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910314664 1:85868609-85868631 TACAGGGAGTACCAGGAGGAAGG - Exonic
911040600 1:93588241-93588263 CACAGGAGTGACCAGGAGGGAGG - Intronic
911189508 1:94933596-94933618 CACTGCAGCTACCAGGAGGAAGG + Intergenic
911286264 1:95997322-95997344 CACAGGAGGGACCAGGTGGGAGG - Intergenic
912511315 1:110192147-110192169 CACAGCAAACACCACGAGGGTGG - Exonic
912531461 1:110326728-110326750 CACAACAAAGAACAGGAGAATGG + Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
914829013 1:151157146-151157168 AACAGGAAGGCCAAGGAGGAAGG + Intronic
914901179 1:151711976-151711998 CACAGCAAGGACCGTGCTGACGG + Intronic
915848660 1:159297379-159297401 CTCAGGACAGACCAGGAGGATGG + Intronic
915956483 1:160224591-160224613 AAAAGCAGGGACCAGGAGGTGGG + Intronic
916228580 1:162516100-162516122 CACAGCAAGATAGAGGAGGAGGG - Intronic
916260034 1:162832647-162832669 CACAGCAAAGGCCAGGAGCCAGG + Intronic
917262197 1:173182308-173182330 AACATCATGAACCAGGAGGAGGG + Intergenic
918550166 1:185733742-185733764 CGTAGAAAGGACAAGGAGGAGGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920136147 1:203770878-203770900 AACCGCAACGACCAGGAGGATGG - Exonic
920203824 1:204277181-204277203 CAGAGCCAGAGCCAGGAGGAGGG - Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920303791 1:205005987-205006009 CAGAACAAGCACCAGGAAGATGG + Intronic
920508824 1:206535924-206535946 GGCAGCAAGGAAAAGGAGGAAGG - Intronic
920536958 1:206743783-206743805 CACCGCAAGGACCTGGAGGATGG - Intergenic
920916736 1:210263808-210263830 CACAGCAAGTGGCAGGAGAAGGG + Intergenic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922202122 1:223413131-223413153 CAAATCAGGGTCCAGGAGGAAGG + Intergenic
923177984 1:231486662-231486684 AACACCAAGGACCTAGAGGAGGG - Intergenic
1062992772 10:1835565-1835587 CACAGCCAGGGCCCCGAGGAGGG + Intergenic
1064572387 10:16707784-16707806 CACAGCATTGACCTGGAGAAGGG - Intronic
1064691956 10:17927461-17927483 CACTGCAACCACCAGGAAGATGG - Intergenic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1066616402 10:37299350-37299372 CACAGCAATGACCACAAGCAAGG + Intronic
1067430991 10:46245774-46245796 CACAGTAAGGACCTGGAGCCAGG + Intergenic
1067442417 10:46316454-46316476 CACAGTAAGGACCTGGAGCCAGG - Intronic
1067727387 10:48780586-48780608 TAGAGCAAGAACCATGAGGAAGG + Intronic
1069577134 10:69538744-69538766 CACAGGAAGGAACTGGAGGTGGG - Intergenic
1069661444 10:70126212-70126234 CTCAGCACAGGCCAGGAGGAGGG - Intronic
1069718398 10:70535008-70535030 CACAGGAAGGACAAGGAAGAGGG + Intronic
1070763867 10:79045181-79045203 GGCAGCTCGGACCAGGAGGAGGG + Intergenic
1071522499 10:86339954-86339976 GACAGGCAGCACCAGGAGGACGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072701700 10:97646710-97646732 ATCAGCAATGACAAGGAGGAGGG - Intronic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1075045491 10:119143166-119143188 CACAGCCAGGCCAAGGAGCAGGG - Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075567992 10:123518506-123518528 CACAGCCCAGACCAGGAGGCAGG - Intergenic
1075668435 10:124246920-124246942 CACTGCAAGGGCCAGCATGAGGG - Intergenic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076045938 10:127294147-127294169 CACCCCAAGTACCATGAGGATGG - Intronic
1076695454 10:132245191-132245213 TACAGCCAGGAGCAGGAGGGAGG + Intronic
1077100949 11:822100-822122 CAGAGCAAGGGCCTGAAGGATGG - Intronic
1077674012 11:4181739-4181761 CACAGCAAGGCCATGGAGGGTGG - Intergenic
1077795628 11:5488846-5488868 CATGGCAATGACCAGGATGAGGG - Exonic
1077870453 11:6258325-6258347 GACAGGCAGTACCAGGAGGAAGG + Intergenic
1078066961 11:8085007-8085029 CCTAACAAGGGCCAGGAGGAGGG - Intronic
1078337880 11:10478069-10478091 CTCAGAAAGGACCAGGAATAGGG - Intronic
1079238181 11:18704269-18704291 TACAGCAGGGACCAAGGGGATGG - Exonic
1079391926 11:20029325-20029347 CACAGCAAGAGCCAGGAGCAAGG - Intronic
1079759558 11:24311174-24311196 CAAGGGAAGGACCAGGAGGGAGG + Intergenic
1079984615 11:27187521-27187543 AACAGCAGGCACTAGGAGGAGGG - Intergenic
1081414134 11:42793112-42793134 CATAGGAAGGACCAGGTGAAAGG + Intergenic
1081694397 11:45099507-45099529 CACAGCCAAGACCAGGAGTGAGG + Intronic
1082870622 11:57941512-57941534 CACAGCTCGGACCCGGAGGTTGG + Intergenic
1083606712 11:63983153-63983175 GACAGGAAGGACCAGCAGCATGG + Intronic
1083638712 11:64133914-64133936 CTCAGCTGGGACCTGGAGGACGG + Intronic
1083702240 11:64487139-64487161 GGCAGCAAGGACCACCAGGATGG + Intergenic
1083894235 11:65612152-65612174 CACAGCAGGGACCAGGAGCAGGG - Intronic
1084433386 11:69123751-69123773 CCCTGCAAGGGCCAGGAGGGAGG - Intergenic
1085650263 11:78261592-78261614 CACACGAAGGAACAGGAGAAGGG - Intronic
1085952067 11:81344123-81344145 CATATAAAGGACCAGGAGGTGGG - Intergenic
1086608159 11:88722375-88722397 CACAGCAAGGGCCCTGAGGCAGG - Intronic
1087119911 11:94562952-94562974 GACAGCAAGGAACAGGAGAGAGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087285781 11:96263879-96263901 CACAGACAGGCCCAGGAAGATGG - Intronic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1089376674 11:117999684-117999706 CTCTGCCTGGACCAGGAGGAGGG + Exonic
1089515100 11:119027198-119027220 CACAGCCAGGATCAGCATGAAGG + Intronic
1090128323 11:124113678-124113700 CACACCAATGAGCAGGAAGAGGG + Intergenic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1091626162 12:2122529-2122551 GAGAGCAAGGACCGGGAGGCCGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091793890 12:3286480-3286502 TAAAGCCAGGACCAGGATGAAGG - Exonic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1096242606 12:49967387-49967409 CACAGCCATGACCAGGAGGATGG + Intronic
1096262998 12:50104535-50104557 CACAGGAAAGTACAGGAGGAGGG - Intronic
1096836218 12:54352967-54352989 CACAGCATTGACCTGGGGGAGGG + Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098895469 12:76055419-76055441 AAAAGGAACGACCAGGAGGAAGG - Intronic
1099322102 12:81162910-81162932 CAGAGCAGGCACCAGGAGCAGGG + Intronic
1100342247 12:93690396-93690418 TACAGCAAGGCCCAGGTTGAGGG + Intronic
1102255991 12:111415319-111415341 CCCAGCGAGGGTCAGGAGGAAGG + Intronic
1102746514 12:115253543-115253565 GACAGAGAGGGCCAGGAGGAGGG + Intergenic
1103076655 12:117988632-117988654 CACAGATAGCACCAAGAGGATGG - Intergenic
1103324654 12:120112334-120112356 CCCAGGCAGGAGCAGGAGGAAGG - Intronic
1103730813 12:123026650-123026672 CCCAGCAAGGCCAAGGTGGAAGG - Intronic
1103731867 12:123033142-123033164 TACAGCAAGAAGCTGGAGGAGGG + Intronic
1103837004 12:123829623-123829645 CACAGCACGGACAGGAAGGAGGG - Intronic
1104224499 12:126818642-126818664 GCCAGCAAGGGCCAGGAGGGTGG - Intergenic
1105001227 12:132690216-132690238 AACAGCAGTGACCAGCAGGAGGG - Intronic
1105899964 13:24745574-24745596 CACAGCAAGGACCAGGAGCACGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106244773 13:27939815-27939837 CTCAGCACGGGCCAGGAGGGAGG + Intergenic
1108431292 13:50356643-50356665 CACAACAGGCATCAGGAGGAAGG + Intronic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1112371115 13:98794516-98794538 CACAGGGAGGACCAAGGGGAAGG - Exonic
1114407564 14:22470952-22470974 CATAGAAAGGACGAGAAGGAAGG - Intergenic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1116551582 14:46246514-46246536 CACAGGAGGGACCAGGTGGGAGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1118986643 14:70761259-70761281 CACAGGAGAGGCCAGGAGGATGG - Intronic
1119187398 14:72652434-72652456 CACAGCAGAGACCAGAAGGATGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119521832 14:75292185-75292207 CACTGCCAGCACCAGGAGCAAGG - Intergenic
1120234642 14:81876351-81876373 CTCTGCTAGGACCATGAGGATGG + Intergenic
1121656487 14:95600291-95600313 CAAAGGAAGGACCTGGTGGAAGG - Intergenic
1123020273 14:105394690-105394712 CACAGCATGGGGCAGGAGGTGGG - Exonic
1123744652 15:23310258-23310280 CACAGCCAGCTCCAGCAGGATGG - Intergenic
1124270138 15:28272911-28272933 CACAGCCAGCTCCAGCAGGATGG + Exonic
1124974540 15:34520605-34520627 GACAGCAAGGCCGAGGAGAATGG + Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125832643 15:42727752-42727774 CACAGCACTGATCAGGAGGGAGG - Exonic
1127953584 15:63833784-63833806 CACACACAGGACCAGGAGGACGG + Intronic
1128557712 15:68642860-68642882 CACAGCAAGGAACAGGAGGTTGG + Intronic
1130532952 15:84761378-84761400 AAGAGCAAGGACCAGGGGGTCGG + Intronic
1130856835 15:87846944-87846966 CGCAGCCAGGGCCTGGAGGAGGG - Intergenic
1131108860 15:89751678-89751700 TAGAGTAAGGACCAGGAGCAGGG + Intergenic
1131871962 15:96772789-96772811 CTCAGAAAGGAGCAGGATGAGGG - Intergenic
1132812942 16:1810434-1810456 CACAGCAAGCACGGGGAGGAGGG + Intronic
1132865324 16:2090280-2090302 CTCAGCAAGGTCAAGGAGGTGGG - Exonic
1133076584 16:3285008-3285030 CACAACAGGGCCCAAGAGGAAGG - Intronic
1133118631 16:3592721-3592743 CAGAGCTAAGGCCAGGAGGAAGG + Exonic
1133303626 16:4797285-4797307 CACTGGAAGTGCCAGGAGGAAGG - Exonic
1133356475 16:5140633-5140655 AAAAGCAAAAACCAGGAGGAAGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136455518 16:30377880-30377902 GACGCCAAGGACCAGGAGTAGGG + Exonic
1136554074 16:30997545-30997567 CAAAGCATTGAACAGGAGGAGGG - Exonic
1136705133 16:32181272-32181294 CACAGCCAGCTCCAGCAGGATGG + Intergenic
1136762779 16:32748134-32748156 CACAGCCAGCTCCAGCAGGATGG - Intergenic
1136805321 16:33122252-33122274 CACAGCCAGCTCCAGCAGGATGG + Intergenic
1136927104 16:34384589-34384611 CACAGCATGGACCAAGACCATGG + Intergenic
1136977470 16:35027218-35027240 CACAGCATGGACCAAGACCATGG - Intergenic
1137482721 16:48865685-48865707 AACAGCAGGGACCTGGGGGATGG + Intergenic
1137571746 16:49570903-49570925 CACGGGCAGGACCTGGAGGAGGG - Intronic
1137629479 16:49932120-49932142 CACCGACAGGACCAGGAAGAGGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138653919 16:58479350-58479372 CTCAGTGAGCACCAGGAGGATGG - Intronic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139579339 16:67863037-67863059 CATAGCAAGTACCAGGTGGACGG + Intronic
1141650797 16:85391989-85392011 CCCAGGAAGGACAAGGACGATGG - Intergenic
1141651833 16:85396998-85397020 CAGAGCAAGGACCAAGAGACGGG + Intergenic
1142219612 16:88847485-88847507 GACAGCAGGGACCTTGAGGAGGG + Intronic
1203064935 16_KI270728v1_random:1008453-1008475 CACAGCCAGCTCCAGCAGGATGG - Intergenic
1142858655 17:2748270-2748292 CAGAGCAAGGCCCTGAAGGATGG - Intergenic
1143407764 17:6689286-6689308 CACAGCCAGGAAAACGAGGATGG - Intronic
1143678331 17:8455200-8455222 AGCAGCAAAGACCAGGATGAGGG - Intronic
1143678335 17:8455228-8455250 CAAAGGAATGACCAGGAAGACGG - Intronic
1145059788 17:19725194-19725216 CCTAGCAAGGCCCACGAGGAAGG - Intergenic
1145790006 17:27620641-27620663 CCCAGCAGAGACCAGGAGCATGG + Intronic
1146489903 17:33273464-33273486 CACAGGAAGGACCTGGGAGAGGG + Intronic
1146501300 17:33367136-33367158 CACTGGAAGCACCAGCAGGAAGG - Intronic
1147460205 17:40563549-40563571 CCCAGCAAGGAGCAAGAGGTGGG - Intronic
1147793511 17:43027353-43027375 CATAACATGGGCCAGGAGGAGGG + Intronic
1147886008 17:43684910-43684932 CACAGGAAGCTCCAGTAGGAGGG + Intergenic
1148596856 17:48863435-48863457 AACACCAAGGATGAGGAGGAAGG - Exonic
1148733306 17:49850991-49851013 CACAGCAGGGACGAGGCGGGGGG + Intergenic
1148849536 17:50548034-50548056 CACCGCCAGGCCCAGGAGGTTGG + Intronic
1149329496 17:55566820-55566842 GCCAGCAAGGACCAGCGGGATGG - Intergenic
1150266009 17:63832871-63832893 CCCAGCAAGGACCCAGAGGGTGG + Exonic
1150679895 17:67276317-67276339 CAGCGCCAGGACCAGGAGAACGG - Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151415401 17:73958998-73959020 GACAGCAAAGCCCAGGAGGGAGG + Intergenic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1151946725 17:77323688-77323710 CACAGCGAGGGACAGGAGGGAGG - Intronic
1152100558 17:78299412-78299434 AAGAGCACGGACCAGGAGGTAGG - Intergenic
1152305102 17:79515703-79515725 CACAGCAAGGACCCAGAGAAGGG - Intronic
1152316176 17:79581696-79581718 CACAGCCAGGGGCTGGAGGAGGG + Intergenic
1153701083 18:7693868-7693890 CACAGCTATGAACAGGAGTAGGG + Intronic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1156149330 18:34223836-34223858 CAAAGCAGGACCCAGGAGGAAGG - Intronic
1156214092 18:34978072-34978094 CCCAGCGAGGACTAGCAGGAGGG - Intronic
1156466103 18:37348641-37348663 AAAAGCCAAGACCAGGAGGAGGG - Intronic
1156863445 18:41864431-41864453 CATAGCCAGGACAAAGAGGAAGG - Intergenic
1157413820 18:47485653-47485675 CACTGCAATGACCAGGCAGATGG - Intergenic
1157576798 18:48749082-48749104 AAAAGCTAGGACCAAGAGGAAGG - Intronic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1160238318 18:77103607-77103629 CACAGCATGGACCAAGAGCAAGG + Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1160933649 19:1582758-1582780 CCCAGCAAGGACCTGGAGTGGGG - Intronic
1160989884 19:1856154-1856176 CACAGCAGGGACCATGGTGAGGG + Intronic
1161803675 19:6430094-6430116 CAGAGCATGGTCCAGGAGGGCGG - Exonic
1162100018 19:8333847-8333869 GACAGCGCCGACCAGGAGGAGGG + Intronic
1162382743 19:10341041-10341063 AACAGCAGGGACCAGTAGCATGG + Intergenic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162805690 19:13137012-13137034 CACAGCAGGCACCCCGAGGATGG + Intronic
1163623184 19:18372863-18372885 CACAGCAAGGATCAGGCAGCTGG + Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164722980 19:30445528-30445550 GACCGCAAGGGCGAGGAGGATGG + Exonic
1164738043 19:30556406-30556428 CACAGCAGGGCTCAGGATGAGGG - Intronic
1164814686 19:31186312-31186334 CACGGGAAGGACCTGGTGGAAGG + Intergenic
1164883796 19:31760181-31760203 CACACCAAGGACCAGGGGTCAGG - Intergenic
1165076503 19:33282539-33282561 CCCACCAGGGACCAGGAGGAGGG - Intergenic
1165169614 19:33882525-33882547 CAAGGCCAGGACCAGGATGATGG - Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165701393 19:37941151-37941173 CACAGCAACACCTAGGAGGACGG - Intronic
1165730792 19:38143370-38143392 CACTGCAAGGAGGAGGAGGAAGG - Intronic
1165735266 19:38171883-38171905 CAGAGCAAGGCCCTGGAGGTAGG + Intronic
1165842063 19:38794119-38794141 TACAGAAAGATCCAGGAGGATGG - Intergenic
1166530860 19:43542779-43542801 CATAGCATGGGCCAGGAGGTGGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167504406 19:49863556-49863578 CACAGCAAAAAACAGAAGGAGGG + Intronic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
1167802270 19:51751909-51751931 TACACCAAGGAACAGGAGGAGGG + Intronic
1168675145 19:58272316-58272338 CAGACCAAGGCCCAGGTGGAAGG + Intronic
925238829 2:2303719-2303741 CAAACCAAGGGCCGGGAGGAGGG + Intronic
925495719 2:4447106-4447128 CCCAGCTGGGACGAGGAGGAAGG + Intergenic
925681947 2:6431722-6431744 CACAGCAGGCAGCAAGAGGAGGG + Intergenic
925971815 2:9111349-9111371 CACAGGGAGGTCCAGGAAGAAGG + Intergenic
926253455 2:11169562-11169584 CACAGAAAGGATCAAGGGGAAGG - Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
927284716 2:21344952-21344974 CACAGCATGGATATGGAGGAGGG - Intergenic
927342494 2:21998190-21998212 CACAGCACTGACCAAGAGAAGGG - Intergenic
927420279 2:22923883-22923905 CACTGGAAGGGCCAAGAGGAGGG - Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
928077751 2:28280644-28280666 ACCAGCACGGATCAGGAGGAGGG - Intronic
929001066 2:37347282-37347304 CACAGCAAGCCCCATGAGGAAGG + Intronic
929777292 2:44937325-44937347 CACTGCCAGGCCCAGGAGGGTGG - Intergenic
930280849 2:49367841-49367863 TGCAGCAAGGAACAGGAGGGAGG - Intergenic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930957185 2:57217159-57217181 CAGAGCAGGTGCCAGGAGGAGGG - Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932974266 2:76579180-76579202 CGGAGCAAAGAACAGGAGGACGG + Intergenic
933116006 2:78472628-78472650 CACAGCAGGAACCAGAAGTAAGG - Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933894588 2:86799307-86799329 CATAGTAAGGAACAGGAGGGCGG - Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937256067 2:120556731-120556753 AGCAGCAAGGACCCTGAGGATGG + Intergenic
938697525 2:133848233-133848255 GCCTGCAAGGACCTGGAGGAAGG - Intergenic
939605813 2:144253951-144253973 CACAGCAGGGAGCAGGAGTTTGG - Intronic
941035942 2:160569492-160569514 CACAGCAAGGAGCAGCAGCAGGG - Intergenic
941686977 2:168456868-168456890 GAGAGCAGGGCCCAGGAGGAGGG - Intronic
943548358 2:189309212-189309234 CACAGCCAGCACCAGGAAAAGGG + Intergenic
946127827 2:217579865-217579887 CACACCTGGGGCCAGGAGGAAGG - Intronic
946833784 2:223751247-223751269 CACAGCCAGGACCAGCACGAAGG + Intergenic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947793984 2:232882945-232882967 GGCAGCAGGGAGCAGGAGGATGG + Intronic
947826231 2:233107698-233107720 GACAGCAAGGGCCTGGGGGAGGG + Intronic
948014116 2:234673858-234673880 GAGAGAAAGAACCAGGAGGAAGG + Intergenic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1169090877 20:2860762-2860784 CACAGCACAGTCCAGCAGGAGGG - Exonic
1169206057 20:3740920-3740942 CAGAGCAGGGACCAGGTGGTGGG + Intronic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170334126 20:15249256-15249278 CGCTGCAAAGACCAGGAGCAGGG + Intronic
1170736954 20:19021071-19021093 GACAGAAAGGCCCTGGAGGAGGG + Intergenic
1171511058 20:25685414-25685436 CTCAGCAAGGACTGGAAGGAAGG + Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1173144800 20:40515277-40515299 CCCTGCAAGGACCTGGGGGAGGG - Intergenic
1173357512 20:42307816-42307838 CACAGGAAGAAACAGGAGGTTGG + Intronic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175336955 20:58202824-58202846 GGCTGCAGGGACCAGGAGGAGGG + Intergenic
1175350521 20:58314942-58314964 GACAGCAAGGACCGTGAGGCGGG + Intronic
1175375644 20:58521849-58521871 CACAGCAAGGGGCAGGGGGATGG + Intergenic
1175456882 20:59122163-59122185 AACAGGAAGAATCAGGAGGAGGG + Intergenic
1175516588 20:59574274-59574296 CACTGGAGAGACCAGGAGGAGGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175921546 20:62452702-62452724 CACAGCAATTACCAGCAGAATGG + Intergenic
1177905425 21:26966898-26966920 CTCTGCTGGGACCAGGAGGAAGG + Intergenic
1178875542 21:36411484-36411506 CACAGCAAACACCAGGCGGTAGG - Exonic
1179070256 21:38064464-38064486 CAAAGCCAGGAGCAGGAGGTGGG - Intronic
1179466648 21:41580272-41580294 CACAGCCAGCAGCTGGAGGAGGG + Intergenic
1180060679 21:45383446-45383468 CACCGCAGGGGCCAGGGGGAGGG - Intergenic
1180207873 21:46273443-46273465 CAGATCATGGACCAGAAGGAGGG - Exonic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1181128643 22:20716560-20716582 CACAGCCTGGAGCAGGAAGAAGG - Intronic
1181141355 22:20807523-20807545 CACAGCAAGGCCCAGCGGAATGG + Intronic
1181452410 22:23032572-23032594 CACCGCATGGACCAGGGTGATGG + Intergenic
1181666881 22:24404665-24404687 AACAGCCAGGAGCAGGGGGAGGG - Intronic
1182420211 22:30245305-30245327 CCCAGCAGGCACCAGGAGAAAGG + Intronic
1182680270 22:32074051-32074073 CACTGCAATGAGCAGGAGGGTGG + Intronic
1183177180 22:36232822-36232844 AAGAGCAGGGTCCAGGAGGAGGG - Intronic
1183698168 22:39434929-39434951 CACAGCAGGTACCCGGAGGTAGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183951149 22:41353809-41353831 GGCAGCAGGGACCAGGAAGAGGG - Intronic
1184977934 22:48076320-48076342 GAGAGCAAGGCCCAGAAGGAGGG + Intergenic
1185402904 22:50627735-50627757 AGCAGCCAGGGCCAGGAGGAGGG + Exonic
950541328 3:13615028-13615050 GACACCAAGGACAACGAGGATGG - Intronic
952257978 3:31711925-31711947 AATAGCAAAGGCCAGGAGGAAGG + Intronic
956691834 3:71885701-71885723 CACAGAAAGGACCAGGAATGGGG + Intergenic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960330015 3:116347679-116347701 CACAGGAAAAACCAAGAGGACGG + Intronic
960536920 3:118825005-118825027 AACAGCTAGGACTAGGATGATGG - Intergenic
961489778 3:127246791-127246813 CACAGCCAAACCCAGGAGGAAGG + Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
962372310 3:134830927-134830949 CTCAGCAAGGGCCTTGAGGAAGG + Intronic
962680955 3:137799949-137799971 CACATCCATGACCAGGAGGGTGG - Intergenic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
968143043 3:196274143-196274165 CAGAGCAGGCACCAGGAGCAAGG + Intronic
968779353 4:2568031-2568053 CAGAGGCAGAACCAGGAGGAAGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971418905 4:26457729-26457751 GACGGCAAGACCCAGGAGGATGG + Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
973013281 4:45104360-45104382 AAAAGCAATGACAAGGAGGATGG + Intergenic
973173429 4:47174308-47174330 CACTGCAAGGCCCAGGAGGGAGG - Intronic
973932667 4:55808724-55808746 CAAAGCAAGGAAAAGAAGGATGG + Intergenic
974678242 4:65124548-65124570 CACAGCAAGCACTAGGAGGAAGG + Intergenic
975779342 4:77821992-77822014 CACAACAATGTCTAGGAGGATGG + Intergenic
975845807 4:78524080-78524102 CAGAGTAGGAACCAGGAGGAGGG - Intronic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
980444656 4:132888646-132888668 CAGAGCATGGGCCAGCAGGATGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
981988934 4:150892475-150892497 CACAGCAAGGAAGAGGATGTAGG + Intronic
982074245 4:151722620-151722642 CACAGAAAGGACAACAAGGAAGG - Intronic
983034790 4:162850229-162850251 AACAGCCAGGACCAGAAGAAGGG + Intergenic
983360086 4:166716627-166716649 CGGAGCAAAGAACAGGAGGACGG - Intergenic
984438435 4:179734304-179734326 CACAGGAAGGACCTGGTGGGAGG - Intergenic
984731374 4:183070880-183070902 CACAGCAAGGACTCTGAGGAAGG - Intergenic
984847354 4:184119295-184119317 CACACCAAGAAACAGAAGGATGG - Intronic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984881381 4:184412707-184412729 CCAAGCAAGGAGCAGAAGGAAGG - Intronic
985587648 5:749164-749186 CACAGCGTGGGCCATGAGGAAGG - Intronic
985661568 5:1159846-1159868 GACTGCAAGGGCCAGGAGGGTGG + Intergenic
985996380 5:3599534-3599556 CGCAGCAAGGACCAGGAAGATGG + Exonic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
992433684 5:76734404-76734426 CACAGCCAATCCCAGGAGGATGG - Exonic
993952414 5:94193151-94193173 CACAGTCAGGAACAGGATGAAGG - Intronic
994278469 5:97869280-97869302 TACAGCAAGAACCAGAAGGAGGG - Intergenic
995152154 5:108861005-108861027 CAAGGGAAGGACCAGGTGGAAGG - Intronic
995183424 5:109249381-109249403 CACAGCATGGAGCATGAGTAAGG - Intergenic
997364755 5:133318800-133318822 CCCACCAAGGTCCAGGAGGAAGG - Intronic
997529423 5:134572786-134572808 CACAGGAAGCACCTGCAGGATGG - Intronic
997668359 5:135650189-135650211 CTCAGCAAGGACTATGAGGTTGG - Intergenic
997849282 5:137316432-137316454 GATATCAAGGACCAGGAGGGAGG - Intronic
998228068 5:140342066-140342088 CCCAGCAAGGACGAGGAGGTGGG - Intronic
998406354 5:141876722-141876744 TACAGCGGGGACCAGGCGGAGGG + Intronic
999812163 5:155138010-155138032 CACAGCAAGGGAGAGGAGGCTGG + Intergenic
999967949 5:156830035-156830057 CGTTGCAAGGACCAGGTGGATGG - Intergenic
1000264225 5:159619469-159619491 CAGAGCAAGGACCCGGGGGCAGG - Intergenic
1001298832 5:170518864-170518886 CACAGCAAGGTCACTGAGGAGGG - Intronic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1002047869 5:176552191-176552213 CCCAGCAAGGGGCAGGAGCAAGG - Intronic
1002575009 5:180169644-180169666 CACAACAAGGATCATGAGCATGG + Intronic
1002859482 6:1067528-1067550 CACAGCCATGACCAGCATGAAGG + Intergenic
1002915771 6:1526535-1526557 CAAGGAAAGGACCATGAGGATGG + Intergenic
1004164387 6:13243001-13243023 CACAGCAAGTTCCATGAAGAAGG + Intronic
1004168306 6:13275869-13275891 GACAGCAAGAACCAGAAGGAGGG - Intronic
1004346895 6:14857239-14857261 CACAGCAAGGAGCAAGAGCGAGG - Intergenic
1005781855 6:29201247-29201269 CAGAGCACGCACCAGGAGCAGGG - Intergenic
1006059644 6:31410776-31410798 CATATCAAGGACCAGAAAGAAGG + Exonic
1007092484 6:39192857-39192879 TACAGAAGGGACCTGGAGGAAGG + Intronic
1007615643 6:43178464-43178486 CACAGCCAGGTCCAGGAGCCAGG + Exonic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1008737281 6:54561067-54561089 CACAGAAAGGCCCAGGAAGTTGG + Intergenic
1009535581 6:64878863-64878885 CAGAGCAATGACCAAGAGGCTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1012965284 6:105667264-105667286 CACAGCAAATACCAGGCGGTAGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014818966 6:125964514-125964536 AACAGCAAGGAGCAGGAGAGTGG - Intronic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016984488 6:149884912-149884934 GACAGCAAGGACTAGAAGGTGGG - Intronic
1017538196 6:155371259-155371281 CACAGGAAGGGTAAGGAGGAAGG - Intergenic
1018048095 6:159982212-159982234 AACAGCAAGGAAGAGGAGCAAGG - Intronic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018432185 6:163730988-163731010 CACAGCAGGAAGCAGGAGGGAGG + Intergenic
1018826338 6:167410182-167410204 CACAACAACCACCAGGAGAAGGG - Intergenic
1019256289 7:54466-54488 CACAGCATGTACCATGATGATGG + Intergenic
1019575333 7:1735034-1735056 CACGGCAAGGCCCAGGAAGGCGG - Intronic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1021823917 7:24528212-24528234 CAAAGCAAGGACCAGCAGGAGGG + Intergenic
1022480205 7:30738654-30738676 CACAGCAAGAACCTGGAGGTGGG + Intronic
1023715823 7:43043132-43043154 TCCAGAAAGGACCAGGAGGGTGG - Intergenic
1024027010 7:45419759-45419781 CACAGCCTGGACTAAGAGGAAGG + Intergenic
1025974612 7:66359752-66359774 CAGATCAGGGGCCAGGAGGATGG - Intronic
1026895521 7:74007990-74008012 CCCCTCTAGGACCAGGAGGAAGG + Intergenic
1028035214 7:85972842-85972864 CAGAGCAGGCACCAGGAGCAAGG + Intergenic
1028728865 7:94121911-94121933 CCAAGCCAGGACCTGGAGGAAGG - Intergenic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030818391 7:114065264-114065286 CACTGCAAGTAACAGGGGGATGG - Intronic
1031021033 7:116627613-116627635 CACAGAAAGGCCCAGAAGGAGGG - Intergenic
1031110897 7:117607208-117607230 CACAGTAAGGACCATAAGGAAGG + Intronic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1033651744 7:143349137-143349159 CATAGAAAAGACCAAGAGGACGG + Intronic
1033777452 7:144628581-144628603 TACAGTAAGTACCAGGAGAAGGG + Intronic
1034412545 7:150948807-150948829 CACAGCTGGAAGCAGGAGGATGG + Intronic
1035470333 7:159105250-159105272 CACAGCAGAGCCCAGGAGGCCGG + Intronic
1035624410 8:1060408-1060430 CACAGCAAGGACACAGCGGAGGG - Intergenic
1035913941 8:3598506-3598528 CACAGCCAGGGCTTGGAGGATGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036655272 8:10673693-10673715 AAGAGCAAGTCCCAGGAGGAGGG + Intronic
1037047223 8:14322283-14322305 CACAGGAAGGACCAGCATCAGGG + Intronic
1037751983 8:21688558-21688580 CACAGTATGGGCCAGGAGCATGG + Intergenic
1037862492 8:22415811-22415833 TCCAAGAAGGACCAGGAGGAGGG + Exonic
1038063139 8:23934512-23934534 GACAGGAAGGCCCATGAGGAGGG + Intergenic
1038218728 8:25587305-25587327 CACATAGAGGACCAGGAGGAAGG + Intergenic
1038569198 8:28645530-28645552 TACAACAACGACTAGGAGGATGG + Intronic
1039458924 8:37727305-37727327 CAGAGCTGGGCCCAGGAGGAGGG + Intergenic
1039551992 8:38450229-38450251 AAGAGCCAGGCCCAGGAGGAAGG + Intronic
1042477464 8:69265110-69265132 TACAGCAAGAATCATGAGGAAGG + Intergenic
1042515783 8:69657418-69657440 CACAGCACTGACAATGAGGATGG - Intronic
1043970761 8:86526058-86526080 CACAGCAAGTGCCAGATGGAGGG + Intronic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045030199 8:98127832-98127854 CAGAGCCAGGACCACAAGGAGGG - Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045655326 8:104381209-104381231 CACAGCAGGGACCAGGAAACAGG - Exonic
1045820092 8:106326696-106326718 CAGTGCAAGGACCATGAGGTGGG + Intronic
1046942806 8:119947392-119947414 CTCAGCATGGACTAGGAGAAAGG - Intronic
1048949756 8:139486198-139486220 CACAGCAAGAGCTTGGAGGAGGG + Intergenic
1049356767 8:142192946-142192968 AACAGGGAGGAGCAGGAGGAAGG + Intergenic
1049463436 8:142740392-142740414 GACAGCCAGGGCCAGGAAGAGGG + Intergenic
1049667601 8:143853433-143853455 CAGAGCAGCGACCTGGAGGAGGG + Intergenic
1049760402 8:144329590-144329612 GACAGCAATGGCCAGGAGGAAGG - Intergenic
1050010316 9:1179352-1179374 CACAGCGTGGAGCGGGAGGAAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052750180 9:32482372-32482394 CACAGCAAGTACGTGGAGAAAGG + Intronic
1053199569 9:36143292-36143314 CACAGAAAGAGCCAGGATGAAGG - Intronic
1054862221 9:69965709-69965731 CATAGCTATGACCATGAGGATGG + Intergenic
1056241894 9:84655905-84655927 CAAAGAAGTGACCAGGAGGATGG - Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056510123 9:87296518-87296540 CACTTCAAGGACTAGAAGGATGG + Intergenic
1056794459 9:89648062-89648084 CACAGCACAGACAAGGGGGAGGG - Intergenic
1056897830 9:90567299-90567321 GGCACCAATGACCAGGAGGAGGG - Intergenic
1057354393 9:94322099-94322121 CTCAGCATGGAGCATGAGGAGGG - Intronic
1057596598 9:96419399-96419421 CAGAGGAAGGACCGGGCGGAGGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057806481 9:98223309-98223331 CCCAGTAAAGACCTGGAGGAAGG + Intronic
1058740212 9:107935329-107935351 GACAGCAGGGAGCAGGAGGATGG + Intergenic
1059066889 9:111094810-111094832 CTCAGCATGGACCGGGAGGTGGG + Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059308064 9:113370090-113370112 CACAGCAAAGACTGGGAAGAGGG - Exonic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1060151205 9:121289435-121289457 CACAGCCAGCACCAGCAGGCAGG - Intronic
1060662162 9:125410887-125410909 CACAGCGAGGGCCGGCAGGAGGG + Intergenic
1060939816 9:127536785-127536807 CAGAGCTAGGACCAGGAGGGTGG - Intronic
1061485129 9:130916689-130916711 CACAGCGAGGACCAGTGGGATGG + Intronic
1061487998 9:130929996-130930018 CACAGCCAGGGCCAGCAGCACGG + Exonic
1061713425 9:132503318-132503340 CACAGCACGGACCAGGAACAGGG - Intronic
1061719784 9:132544450-132544472 CACAGCCAGGGCCAGGATGGAGG - Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061971591 9:134048282-134048304 CCCAAGAAGGACCTGGAGGACGG - Exonic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1188016328 X:25111798-25111820 CCCTGCAAGCACCAGGATGAGGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1189318028 X:40069509-40069531 CACAGCAAGGGCAAGAAGGCTGG + Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1191737827 X:64406006-64406028 GACAGAAAGGAACAGAAGGAGGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1193087777 X:77462712-77462734 CTCACCAGGGACTAGGAGGAGGG - Intergenic
1195675939 X:107507154-107507176 CACTCCAAAGACCAGGTGGAGGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197321239 X:125033558-125033580 TACAGTAAGTAGCAGGAGGAAGG + Intergenic
1198310650 X:135424174-135424196 CACAGGGAAGATCAGGAGGACGG + Intergenic
1199941052 X:152628219-152628241 GACAGGAAGGAGGAGGAGGAAGG + Intergenic
1200236507 X:154470259-154470281 CACAGCAAAGACCCGAAGAAAGG - Intronic
1200702921 Y:6417440-6417462 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200703215 Y:6419824-6419846 CCCTGCAAGGACCAGGATGAAGG - Intergenic
1200709320 Y:6469410-6469432 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200709930 Y:6474156-6474178 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200910743 Y:8529368-8529390 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1200917051 Y:8580481-8580503 CCCAGCAAGGCCCAGGATGAAGG + Intergenic
1200918866 Y:8595371-8595393 CACTGCAAGGCCCAGGATGAAGG + Intergenic
1200920932 Y:8612321-8612343 CACTGCGAGGCCCAGGATGAAGG + Intergenic
1200930426 Y:8691962-8691984 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200938470 Y:8758890-8758912 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1201024185 Y:9690552-9690574 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1201024792 Y:9695298-9695320 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1201030895 Y:9744883-9744905 CCCTGCAAGGACCAGGATGAAGG + Intergenic
1201031189 Y:9747257-9747279 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1202177919 Y:22114615-22114637 CCCTGCAAAGACCAGGATGAAGG - Intergenic
1202183282 Y:22157600-22157622 CTCTGCAAGGCCCAGGATGAAGG - Intergenic
1202208077 Y:22428801-22428823 CTCTGCAAGGCCCAGGATGAAGG + Intergenic
1202213442 Y:22471780-22471802 CCCTGCAAAGACCAGGATGAAGG + Intergenic
1202258391 Y:22943690-22943712 CACGGAAAGGGCCAGGAGGTTGG - Intergenic
1202411381 Y:24577448-24577470 CACGGAAAGGGCCAGGAGGTTGG - Intergenic
1202459401 Y:25092624-25092646 CACAGAAAGGGCCAGGAGGTTGG + Intergenic