ID: 1105903245

View in Genome Browser
Species Human (GRCh38)
Location 13:24776748-24776770
Sequence GGAACTGCCTCCTTCAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105903245 Original CRISPR GGAACTGCCTCCTTCAGAGG GGG (reversed) Intronic
900467351 1:2832315-2832337 AGGGCTGCATCCTTCAGAGGGGG - Intergenic
900500822 1:3003716-3003738 GGACATGCCCCCTCCAGAGGTGG - Intergenic
900535759 1:3176410-3176432 GGTCCTGCCTCTTTCAGAGCAGG + Intronic
900535987 1:3177929-3177951 GGTCCTGCCTCTTTCAGAGCAGG + Intronic
900744994 1:4355046-4355068 GCAACGGCATCCTCCAGAGGGGG + Intergenic
901148500 1:7084628-7084650 GGAACAGCTTCCTTCACATGTGG + Intronic
901780821 1:11593455-11593477 GCAACAGCCACCTGCAGAGGCGG + Intergenic
902747732 1:18484446-18484468 GTCACTGTCTCCCTCAGAGGTGG - Exonic
902834532 1:19038109-19038131 GGGGCAGCCTCCTTCAGTGGGGG - Intergenic
905037101 1:34925452-34925474 GGAGCTGGCTCCTTCAGAAAGGG - Intronic
905311996 1:37055767-37055789 GGTACTGCCTCCTGCACAGCAGG + Intergenic
905633416 1:39531763-39531785 GGAGCTGCCAGCCTCAGAGGAGG - Intergenic
905664328 1:39753408-39753430 GGAACTGCCAGCCTCAGAGGAGG + Intronic
907471081 1:54673851-54673873 GGTACGGGCTCCTTCAGAAGTGG - Intronic
907833180 1:58084734-58084756 AGAAATGCCTACTTCAGAGGGGG + Intronic
908485248 1:64585499-64585521 GAATGTTCCTCCTTCAGAGGTGG + Intronic
909596519 1:77412555-77412577 GTATCTGCCTCCTGCAGGGGAGG - Intronic
914392890 1:147237542-147237564 GGCCCTGCCTCCTTCTGAGTTGG - Intronic
914677500 1:149916173-149916195 GGTCCTGCCTCCTTCAGGGCTGG - Intronic
915913447 1:159928247-159928269 GTAGCTGCCTCCTGCAGAGGGGG + Exonic
920006096 1:202834965-202834987 TGAGCTGGCTCCTGCAGAGGAGG - Intergenic
920298842 1:204976204-204976226 GGAACTGTCTCCTATAGAGAGGG - Intronic
921266994 1:213429126-213429148 GGAACATCCTACTTCAGGGGAGG - Intergenic
921270783 1:213467664-213467686 GGATCTGCTCCCTTCAGTGGTGG + Intergenic
924133985 1:240943806-240943828 AGACCTGCCTGCTTTAGAGGAGG + Intronic
924593828 1:245428068-245428090 GGCCCTGCCTCCTTCACTGGTGG + Intronic
1063534828 10:6873177-6873199 GGAACTGCCTCTTCCCTAGGTGG - Intergenic
1065093638 10:22260328-22260350 GGAGCTGCTTCCTTTAGAGTTGG - Intergenic
1065299932 10:24312095-24312117 TGGGCTTCCTCCTTCAGAGGAGG + Intronic
1067733835 10:48833695-48833717 GGCACTGACTTCTTCAGAGGTGG + Intronic
1069547608 10:69339770-69339792 GGATCTGCCTTCTGCAGAGCAGG + Intronic
1069809528 10:71148131-71148153 ACAACTGCCTCCTTCAGGGAGGG + Intergenic
1070264418 10:74888052-74888074 ACACCTGCCTCTTTCAGAGGTGG + Intronic
1070786378 10:79164707-79164729 AAAGCTGCCTCCTGCAGAGGTGG + Intronic
1073303063 10:102482614-102482636 GGCCCTGTCTCCTGCAGAGGAGG - Intronic
1073453759 10:103624316-103624338 GGACCTGCTTCCTCCAGAGTGGG - Intronic
1073819368 10:107243210-107243232 TTAACTAACTCCTTCAGAGGAGG - Intergenic
1075782908 10:125028281-125028303 GGAACAGCCCCTTCCAGAGGGGG - Intronic
1076691242 10:132224795-132224817 GGAGCTGGCTTCCTCAGAGGTGG + Intronic
1081762287 11:45584802-45584824 GGAGCTGCCTCACTCAGAGAAGG + Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084149557 11:67281805-67281827 GGGACTGCCTCCCTCAGGTGGGG + Exonic
1084551022 11:69842193-69842215 CGAGCTGCTTCCTTCAGAGAGGG + Intergenic
1087144640 11:94799748-94799770 GGAACTGCCCACTTACGAGGAGG + Exonic
1088190856 11:107226579-107226601 GGAACTGCCTCCTGCTTAGTAGG + Intergenic
1089390614 11:118099208-118099230 GGGACTGCCTCTTACTGAGGGGG - Intronic
1091330880 11:134730054-134730076 GGCTATGCCTCCTTCAGAGGTGG + Intergenic
1094111899 12:26870823-26870845 GGAACTGAGTCCTTCAGCTGTGG - Intergenic
1094266609 12:28566863-28566885 AGAGCTGCCTCCTGCAGATGGGG - Intronic
1095033344 12:37322925-37322947 GGAACTGCGTTCTTTGGAGGAGG + Intergenic
1097275415 12:57810170-57810192 AGAACTGCCTCCTTGAGTGGGGG + Intronic
1101424345 12:104575730-104575752 AGAACAGCCTCCTTCAGAAGAGG - Intronic
1103337298 12:120199301-120199323 GGAACTGACTTCTCCAGAGCTGG + Exonic
1104716736 12:131020596-131020618 GCAACTGCCTCGTTCAGACCTGG - Intronic
1105596347 13:21843066-21843088 GGGTTTGCCTCCTTCAGAGTTGG - Intergenic
1105903245 13:24776748-24776770 GGAACTGCCTCCTTCAGAGGGGG - Intronic
1113664822 13:112134238-112134260 GGAACTTTCTCCGCCAGAGGTGG + Intergenic
1114266681 14:21076461-21076483 GGAACTGCCTGTTTGAGGGGTGG - Intronic
1114419820 14:22572130-22572152 TGACCTGCCTCTTTCAGAGTAGG + Intronic
1114548934 14:23522402-23522424 TGAACTGCCTGCTCCAGGGGAGG - Exonic
1117202522 14:53406807-53406829 GTTACTGCATCATTCAGAGGGGG - Intergenic
1117463169 14:55966931-55966953 GGATCTGCTTCCTTCAGAAATGG - Intergenic
1118939312 14:70317821-70317843 AGAGCTGCCTCCCTCAGGGGTGG - Intergenic
1124237864 15:28005189-28005211 GAATCAGCCTCCTTCTGAGGAGG - Intronic
1126393352 15:48183212-48183234 GTAACTGTCTCCTTCATATGTGG - Intergenic
1127056991 15:55142265-55142287 GAAACTGGGTCCTTGAGAGGTGG + Intergenic
1128551724 15:68601923-68601945 AGAGCTGCATCCTCCAGAGGGGG + Intronic
1128822938 15:70677848-70677870 GGAAGTGCCCCCCTCAGAAGCGG + Intronic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1130550002 15:84884347-84884369 GGCCATGCCTCCTTGAGAGGAGG + Intergenic
1131859753 15:96639991-96640013 GGAAATGCCTCCTACAAATGTGG + Intergenic
1133212847 16:4272760-4272782 GGACCTGGCTCGTGCAGAGGAGG - Exonic
1133337744 16:5017159-5017181 GGAACTGCCTGTTCCAGAGGCGG + Exonic
1134010306 16:10847098-10847120 GGAGCTGCCCCCTCCAGAGAGGG - Intergenic
1134440565 16:14297319-14297341 GGCACAGCCTCCTTCTGATGGGG + Intergenic
1134744261 16:16575169-16575191 AGAAGTGCCTCCTTCAGGCGGGG + Intergenic
1134838833 16:17384597-17384619 GGCACTGTCTACTTCAGATGTGG + Intronic
1134862008 16:17568630-17568652 GGGGCTGCTTCCTGCAGAGGTGG - Intergenic
1135001223 16:18778589-18778611 AGAAGTGCCTCCTTCAGGCGGGG - Intergenic
1135274988 16:21104500-21104522 GGAACTTGCTCCTTCACAAGAGG - Exonic
1135960796 16:26993157-26993179 GCAACTGCCTTCATCAGAGCTGG - Intergenic
1137675443 16:50301689-50301711 GGAACTGCCTCCTCCACCGTGGG - Intronic
1138177208 16:54911144-54911166 GGCACTGCCATATTCAGAGGTGG - Intergenic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1138840908 16:60504780-60504802 GGAACTGCTTCAGTCAGATGTGG + Intergenic
1141973235 16:87496421-87496443 GGCCCTGCCTCCTTGTGAGGGGG + Intergenic
1143471451 17:7178333-7178355 GGAACTGCCTCTCTCAGGAGAGG - Intronic
1145908797 17:28530992-28531014 GGAACTCTGTCCTTCTGAGGTGG - Intronic
1145963529 17:28901421-28901443 GCAACTGCCCCCTCCAGCGGGGG - Intronic
1146534637 17:33639564-33639586 GGAGCTGCCTCCTTGGGAGTGGG + Intronic
1147531627 17:41283980-41284002 GGAACTGCATTCTACAGAGCAGG + Intergenic
1148821772 17:50364128-50364150 GGAACAGCTTCATTCAGAGCAGG - Intergenic
1149408716 17:56381384-56381406 GGAACTGCGTTCTTTGGAGGAGG - Intronic
1150297739 17:64022612-64022634 GGAACTGCCTCATTCACAGAAGG - Intergenic
1150638471 17:66933205-66933227 GGAGCTGGCACCTTCAGAGATGG + Intergenic
1150811088 17:68357754-68357776 GTAGCTGCCCCCTTCAGATGGGG - Intronic
1151704148 17:75757917-75757939 GTACCTGCCTCCTCTAGAGGTGG - Intronic
1157173130 18:45426389-45426411 AGACATGCCTCCTTCAGCGGTGG + Intronic
1161389962 19:4015713-4015735 GGAACTGGGTCCTCCGGAGGCGG - Intronic
1161560977 19:4972266-4972288 GGAAGTGACTGCCTCAGAGGAGG - Intronic
1164246524 19:23435175-23435197 GGAACTGCTTCCTTTGGAGGAGG + Intergenic
1165767117 19:38358543-38358565 GCAACTTCCTCCTGCAGAGGTGG + Exonic
1166880457 19:45926766-45926788 GGAGCTGCATCCTTCTCAGGAGG - Intergenic
926635022 2:15169555-15169577 GAACCTGCCTCTGTCAGAGGAGG - Intronic
928129215 2:28637552-28637574 TGGCCTGCCTCCTTCAGAGGTGG - Intronic
930089234 2:47519882-47519904 AGAGGTGCCTCCTTCAGAGGAGG + Exonic
931350732 2:61485922-61485944 AGAACTGCATCCAACAGAGGGGG + Exonic
932071157 2:68621753-68621775 GGAAATGCCTCATTAAGAGATGG + Intronic
936077142 2:109408735-109408757 GAAAGTGCCTCCTTTACAGGCGG - Intronic
936403474 2:112183327-112183349 GGTGCTGCCCCTTTCAGAGGTGG - Intronic
938403448 2:131013112-131013134 AGAACTGCCAGCTTCAGAGGAGG + Intronic
941061770 2:160855767-160855789 GGAACTGCGTCCTTTGGAGGAGG + Intergenic
945201391 2:207285250-207285272 GGTACAGCCTCCTTCACAGGTGG + Intergenic
946355415 2:219181525-219181547 GGAGCTGCCACCTCCAAAGGAGG + Intronic
948077583 2:235177635-235177657 AGTACTGCCTCCTTAAGAGATGG - Intergenic
948383013 2:237564094-237564116 AGACCTGCCTCCCTGAGAGGTGG - Intergenic
948740215 2:240041593-240041615 GGAACTGTCTGGTCCAGAGGAGG + Intergenic
948757519 2:240168117-240168139 GGAACAGCCTCCGTCCCAGGAGG - Intergenic
949076002 2:242058308-242058330 GGAAATGCCTTCTTCAGTAGGGG + Intergenic
1169422521 20:5471586-5471608 GGGCCGGCCTCCTTCAGAGCTGG + Intergenic
1171139723 20:22730160-22730182 GGAGCTGCAGCCTTCAGTGGAGG + Intergenic
1172156953 20:32833315-32833337 GAAATTGCCTCCTGAAGAGGAGG + Intronic
1173031852 20:39368424-39368446 GGAACTGCTTCCCTTGGAGGAGG - Intergenic
1173606281 20:44334199-44334221 GGAACAGCCTTCTTCAGTGGGGG + Intergenic
1173707708 20:45124575-45124597 GGAAATGGCCCCTTCTGAGGAGG + Intergenic
1175856466 20:62123127-62123149 GGAGCTGGCACCTGCAGAGGTGG - Intronic
1176042647 20:63073407-63073429 GGAAGCCCCTCCTTCAGAGCAGG - Intergenic
1177810446 21:25919325-25919347 GGAACTGCGTTCTTTGGAGGAGG - Intronic
1183033948 22:35126666-35126688 GGAACTGACGCCTGCAGAGGTGG - Intergenic
1183465552 22:37978504-37978526 GGAATTGGCTACTTCAGTGGGGG + Intronic
1184184212 22:42853488-42853510 AGAAGTGCCCCTTTCAGAGGTGG - Intronic
1184260727 22:43314341-43314363 GCAGCTGCCTGCTTCAGAGGGGG - Intronic
1184714892 22:46275589-46275611 GGTACTACCTCATTCACAGGTGG - Intronic
1184879388 22:47295399-47295421 GGGACTGCCTCCCTCAGTGAGGG + Intergenic
950414654 3:12862003-12862025 GGAGGTGCCTCCCTCAGAGCTGG + Intronic
951043361 3:18012294-18012316 AGAGCTGCTTCCTTCAGTGGTGG - Intronic
953660334 3:44887280-44887302 GCATCTGCCTCCTCCAGACGAGG + Intronic
953765392 3:45736917-45736939 GGGAATGACTCCTTCTGAGGTGG + Intronic
954043540 3:47909296-47909318 CGAAGCTCCTCCTTCAGAGGTGG - Intronic
954636838 3:52075550-52075572 GGAGCCACCTCCTCCAGAGGGGG + Exonic
956499783 3:69869808-69869830 GGAACTGCCTCCCCCTCAGGAGG + Intronic
959871719 3:111336653-111336675 GGAACTGCCTCATTCTGATAAGG - Intronic
961634383 3:128323725-128323747 GGGGCTGGCTCCTTCAGGGGAGG - Intronic
962313716 3:134344760-134344782 GCAGCTGCGTCCTTCAGATGAGG - Intergenic
963841659 3:150114019-150114041 GGAACTGCCACCTTCATCGGTGG - Intergenic
966800109 3:183755455-183755477 GGAACTTGCTACTTCAGAGGTGG + Intronic
966945222 3:184773096-184773118 CGAACTGCCTCCTACACAGGTGG + Intergenic
968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG + Intergenic
969323042 4:6424612-6424634 GCCAATGCCTCCTCCAGAGGCGG + Intronic
973627406 4:52786695-52786717 GGCTCTGCCTCCTCCAGTGGTGG - Intergenic
975847644 4:78541774-78541796 AGAACTCCCTCCTACAAAGGGGG + Intronic
978312949 4:107406125-107406147 AGAGCTGCCTACTTCAGATGGGG - Intergenic
981561652 4:146054919-146054941 GGAGGTGTCTGCTTCAGAGGAGG + Intergenic
983814004 4:172099949-172099971 TGAATTGCCTCTTTCAGTGGTGG - Intronic
985077598 4:186232147-186232169 GAAAACGCCTTCTTCAGAGGTGG + Exonic
985709045 5:1417913-1417935 GGAACTGGGTGCTGCAGAGGGGG + Intronic
986455497 5:7914155-7914177 GGAGATGCATCCTTCAGTGGAGG + Intergenic
987390812 5:17373823-17373845 GGGACTGCCTCCTTTAGAATGGG + Intergenic
988385134 5:30553238-30553260 GCAACTCCCTCATCCAGAGGAGG - Intergenic
998330252 5:141319710-141319732 GCAACTGGCTCCTCCACAGGAGG + Exonic
999141360 5:149364544-149364566 CTGGCTGCCTCCTTCAGAGGGGG - Intronic
999957372 5:156717548-156717570 GGAACTGCCTCTTGCAGGGTTGG + Intronic
1000576431 5:162980851-162980873 GGATAGGCATCCTTCAGAGGAGG + Intergenic
1003941163 6:11028445-11028467 GAAACTGTCTCCATCAGAAGAGG + Intronic
1006735107 6:36267885-36267907 GGGGCTGCCTCCTGCAGAGTTGG - Intronic
1007475150 6:42114694-42114716 GGAAAAGCCTCCTTAAGAAGAGG + Intronic
1007574440 6:42916045-42916067 GGTCCTGCCTCCTTCCGAGTGGG + Exonic
1008217843 6:48817007-48817029 AGTTCTGCCTCCTTGAGAGGGGG - Intergenic
1009482616 6:64178647-64178669 TCAATTTCCTCCTTCAGAGGAGG - Intronic
1009702707 6:67203200-67203222 GTCACTGCCTCCTGCAGAGATGG - Intergenic
1012867523 6:104635521-104635543 GTCACTGTCTCCCTCAGAGGAGG - Intergenic
1012950302 6:105511300-105511322 TGAATTGGCTTCTTCAGAGGTGG + Intergenic
1014999990 6:128202630-128202652 GGAACTCCGTCCTTCTTAGGTGG - Intronic
1019325827 7:437802-437824 GGAACTTCCTCCTTCAGTCCGGG + Intergenic
1019935929 7:4257947-4257969 AGAACTGCTTCCTTCAAAGAAGG + Intronic
1025577619 7:62667944-62667966 GGAGCTGCATTCTTTAGAGGAGG - Intergenic
1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG + Intergenic
1028645874 7:93096081-93096103 GGAACTGTGACCTTCAGTGGAGG - Intergenic
1028899664 7:96083448-96083470 GGATCTACCTCTTTCAGAAGTGG - Intronic
1028956281 7:96696239-96696261 GGAACTGGCTCATGAAGAGGGGG + Intronic
1030187214 7:106775982-106776004 TGAACAAACTCCTTCAGAGGGGG - Intergenic
1032713805 7:134486987-134487009 AGAAATGCATCCTTCTGAGGAGG + Intergenic
1033216179 7:139495275-139495297 CCAACTGCCCTCTTCAGAGGAGG + Intergenic
1033317871 7:140313352-140313374 GAAACTGCCTCCTCTAGATGGGG - Intronic
1034701500 7:153099980-153100002 GGAGCTGCCTGCTTCACATGTGG + Intergenic
1036614431 8:10377766-10377788 GCAAGTGACTCTTTCAGAGGAGG + Intronic
1037949408 8:23008968-23008990 GGGACTGCCTCCCTCAGGGCTGG - Intronic
1040294045 8:46140046-46140068 GGAGATGCCTCCTTAGGAGGCGG + Intergenic
1043863350 8:85347855-85347877 GGACCCGCCCTCTTCAGAGGTGG - Intronic
1046792314 8:118335149-118335171 GGAAGTTCCTCCTTTAGTGGTGG - Intronic
1050206095 9:3197834-3197856 GGAGATGCCTCCTTCAAATGTGG - Intergenic
1051172078 9:14329015-14329037 GCAACTGCCCCCTTTAGATGGGG + Intronic
1055381863 9:75716121-75716143 GAAACTGCCTCCGTCAAATGCGG - Intergenic
1058377613 9:104341661-104341683 GTTGCTGCGTCCTTCAGAGGAGG - Intergenic
1058883380 9:109304667-109304689 GGAACTGCCTACTCCATGGGGGG + Intronic
1059329936 9:113528573-113528595 GCAACTGCCTCCTTCAGCAGAGG - Intronic
1061208808 9:129178954-129178976 GGAACTCTCTCCATCAGAGAAGG - Intergenic
1061224555 9:129273213-129273235 GGAACTGCTCCCTGCAGAGCAGG - Intergenic
1061833388 9:133310973-133310995 GGAACTGCTTCCTTTGGAGGAGG - Intergenic
1062078565 9:134605965-134605987 GGAACTGTCTCCTTCTCAGATGG + Intergenic
1062270447 9:135705852-135705874 GGAAGGCCCTCCTTGAGAGGGGG + Intronic
1185484136 X:469351-469373 GGAACTGCTTCCTGGGGAGGGGG + Intergenic
1187271035 X:17779851-17779873 TGAACTGCCTGATTCAGATGTGG + Intergenic
1188082121 X:25856261-25856283 GGAAATGACTCCTGAAGAGGGGG - Intergenic
1190451719 X:50588580-50588602 GGAACTGCCTCTGTAAGAGAAGG + Intergenic
1196314533 X:114208058-114208080 GGAACTGCAGCCTTCAGAAGTGG - Intergenic
1199364904 X:146970167-146970189 GGAACTGCATCCTTGTGAGGGGG - Intergenic
1199382467 X:147185603-147185625 GGAACTGCATCCTTGTGAGGGGG + Intergenic
1199771094 X:150975860-150975882 GCACCGGTCTCCTTCAGAGGAGG - Intergenic