ID: 1105905413

View in Genome Browser
Species Human (GRCh38)
Location 13:24804964-24804986
Sequence GACAACAGTGTCTTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105905413_1105905414 -8 Left 1105905413 13:24804964-24804986 CCTGTGAGAAAGACACTGTTGTC 0: 1
1: 0
2: 1
3: 27
4: 252
Right 1105905414 13:24804979-24805001 CTGTTGTCTCCATTTGAATGTGG 0: 1
1: 0
2: 0
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105905413 Original CRISPR GACAACAGTGTCTTTCTCAC AGG (reversed) Intronic
900716928 1:4150934-4150956 GACAAGAGTGACTTTCACAGAGG - Intergenic
901674344 1:10874274-10874296 GACAACAGTCTCTCTCTCCCAGG + Intergenic
902106265 1:14038611-14038633 GACACCAGTGCCTTCCTCCCTGG + Intergenic
902434828 1:16391759-16391781 GACATCAGTTTCTTTCTCTGTGG + Intronic
903134367 1:21299721-21299743 GACAACAGTGTCTCCCTCATAGG + Intronic
903623900 1:24717674-24717696 GACCTCAGTCTCTTTATCACTGG - Intergenic
903885370 1:26537842-26537864 GGAAACAGTGTCTGTCTCACAGG + Intronic
904976297 1:34459484-34459506 AATAATAGTGTCTATCTCACAGG - Intergenic
905284420 1:36869970-36869992 GACAGCAGTGGATTTCACACTGG + Intronic
907955447 1:59223774-59223796 GATAATAATGTCTCTCTCACAGG + Intergenic
908151333 1:61305815-61305837 GAAGACAGTGTCTTGCTAACAGG - Intronic
908441548 1:64159956-64159978 TACAACAGAGTCTTTCTTTCAGG + Intronic
908784656 1:67722965-67722987 AACAAGAGTGCCTATCTCACAGG + Intronic
908826514 1:68137869-68137891 GTGAACAGTGCCTTTTTCACAGG - Exonic
909416408 1:75410936-75410958 GACAAAATTCTCATTCTCACTGG - Intronic
910107279 1:83645133-83645155 ACCAGCAGTGTCTTTCTCCCTGG - Intergenic
910701069 1:90074700-90074722 AACAACAGTGTCTTCCACAGCGG - Intergenic
911149644 1:94584888-94584910 GACTAAAGTGTCTATTTCACTGG - Intergenic
911428513 1:97753189-97753211 AACAACAGTATCTATCTCATTGG - Intronic
913670506 1:121093818-121093840 GACAATAATTTCTTTCCCACAGG - Intronic
914022273 1:143881260-143881282 GACAATAATTTCTTTCCCACAGG - Intergenic
914660758 1:149789186-149789208 GACAATAATTTCTTTCCCACAGG - Intronic
915712736 1:157916906-157916928 GACAAAAGTCTCCTTCTCCCAGG - Intergenic
917083556 1:171282117-171282139 GACATCATTGTCTTTGCCACTGG + Exonic
917687397 1:177431317-177431339 AACCACAGTGTCTTGCTGACAGG + Intergenic
919950979 1:202363249-202363271 TACAACTGTGTCTTGCTCTCAGG + Intronic
921158543 1:212456557-212456579 GACAGCAGTATCAATCTCACAGG - Intergenic
922002710 1:221495969-221495991 GACATCAGTGTCTGTCTGAAAGG - Intergenic
922326968 1:224536914-224536936 AAAAACAGTGTCTTCCTTACAGG + Intronic
922902524 1:229147897-229147919 CACACCAGTGTCTTTCTCTGGGG - Intergenic
922982885 1:229843022-229843044 CAAAACAGTCTCTGTCTCACTGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1066163598 10:32761197-32761219 AAGCACAGTGTCTCTCTCACTGG + Intronic
1067480529 10:46594182-46594204 GAAAACAATGTCTGTCTCAAGGG + Intergenic
1067614210 10:47747617-47747639 GAAAACAATGTCTGTCTCAAGGG - Intergenic
1067955812 10:50789372-50789394 GACAACTGTGTCCTACTCCCTGG + Intronic
1068937749 10:62652643-62652665 GACATCAGTGTCTTGCACAATGG + Intronic
1069631429 10:69899255-69899277 AATAACAGTGTCTATTTCACAGG + Intronic
1069782976 10:70968469-70968491 GCCAACTCTGTCTCTCTCACAGG + Intergenic
1070374450 10:75815867-75815889 AACAGCAGTATCTTTTTCACAGG - Intronic
1070449593 10:76544421-76544443 GTCAGCAGTGTCTGTCTGACTGG + Intronic
1070644368 10:78191314-78191336 GACCTCTGTGTCTCTCTCACTGG + Intergenic
1071350418 10:84735405-84735427 AATAAAATTGTCTTTCTCACAGG - Intergenic
1071629617 10:87207593-87207615 GAAAACAATGTCTGTCTCAAGGG - Intergenic
1073045107 10:100632573-100632595 GACAACAATATCTTCCTCATGGG + Intergenic
1073598626 10:104824470-104824492 TACAACAGAGTCTCTCTTACAGG - Intronic
1075407900 10:122206748-122206770 GAGAACAGTGCCTTGCACACAGG - Intronic
1077617192 11:3685059-3685081 AATAACAGTGTCTATCTCACAGG + Intronic
1077801332 11:5541273-5541295 GACATCAGTTTCTTTTTCACTGG + Intronic
1080261474 11:30353929-30353951 GATCACACTGTCTTCCTCACTGG - Intergenic
1081013427 11:37845009-37845031 GACAACAGTGTCTGAGTCTCTGG - Intergenic
1081098626 11:38972237-38972259 GACTTCAGTGACTTTCCCACAGG + Intergenic
1081776727 11:45680905-45680927 GAGACCAGTGCCTTCCTCACAGG - Intergenic
1082110546 11:48268874-48268896 GGAAACAGTGGCTTTCTCATGGG + Intergenic
1083927059 11:65814234-65814256 GTAAACAGTGTCTTGCTGACAGG + Intergenic
1084525149 11:69692789-69692811 AACAACAGTGGATTTCTCATTGG + Intergenic
1084684493 11:70685770-70685792 GACACAAGTCTCCTTCTCACTGG + Intronic
1085511395 11:77090038-77090060 GCCAACAGTGCCCATCTCACAGG + Intronic
1085991860 11:81857803-81857825 GTGACCAGTGTCCTTCTCACAGG + Intergenic
1086464164 11:87036730-87036752 GATAAAAGTATCTTTCTCTCAGG - Intergenic
1086541986 11:87924123-87924145 GAAAATAGTGTCCTTCTTACAGG - Intergenic
1087322139 11:96676272-96676294 GACAAGATTGTCTTTCTGAGGGG + Intergenic
1088051497 11:105520807-105520829 GCTACCAGTGTCTTTCTCAAGGG - Intergenic
1096223881 12:49851968-49851990 AACAACAGTGGATCTCTCACCGG + Intergenic
1096925309 12:55137443-55137465 AACCACACTGTCTTTCACACTGG + Intergenic
1097125799 12:56773937-56773959 GACAAGTATGTCTTTATCACGGG + Exonic
1098842641 12:75494889-75494911 GACAACAGTAACTTCCTCATAGG + Exonic
1099967750 12:89468797-89468819 GAGAAGAGTTTCTTTTTCACAGG - Intronic
1100079342 12:90828615-90828637 GACAACAGTTCCTTTCTTTCAGG - Intergenic
1101201581 12:102441750-102441772 GATAACAGTGTCCATCTCATAGG - Intronic
1101329809 12:103748535-103748557 GACAACAATGTCTATCTCACAGG + Intronic
1101655534 12:106716808-106716830 GATAAGAGTGTCTTCCTCATGGG - Intronic
1103362144 12:120360780-120360802 CATAACAGTGTCTATCTCACAGG + Intronic
1103893679 12:124258713-124258735 CACGACAGTGTCTTTGTAACTGG + Intronic
1105804308 13:23942055-23942077 GACAATAGTAGCTTTCTCAAAGG + Intergenic
1105905413 13:24804964-24804986 GACAACAGTGTCTTTCTCACAGG - Intronic
1108917031 13:55627132-55627154 GAAAAATGTGGCTTTCTCACTGG - Intergenic
1110907536 13:80911305-80911327 AACAACAATGTCTATCTCATAGG + Intergenic
1111887389 13:94039509-94039531 AACAGCACTGTCTTTCTCTCAGG - Intronic
1114056479 14:18972417-18972439 GAAAATAGTAGCTTTCTCACAGG - Intronic
1114106071 14:19429310-19429332 GAAAATAGTAGCTTTCTCACAGG + Intronic
1115807251 14:37064803-37064825 TACTACAGTGTCTGTCTCATAGG - Intronic
1118688963 14:68319908-68319930 GATAACAGTATCTGTCTCATAGG - Intronic
1119287341 14:73466378-73466400 GACATCAGTGTCTTCCTCATTGG + Intergenic
1120518805 14:85501985-85502007 GACAACAGTGTCTCTCTGAATGG + Intergenic
1121424224 14:93836986-93837008 AACAAAAGTTTGTTTCTCACAGG + Intergenic
1121452423 14:94017635-94017657 CACAAGAGTCACTTTCTCACTGG - Intergenic
1121672749 14:95725408-95725430 GACAACAGTGGCACCCTCACTGG - Intergenic
1122453647 14:101832946-101832968 GATAACAGTTTCTCTCTCACAGG + Intronic
1125714634 15:41812557-41812579 GACAGCAGTGTCCTTCTCTGAGG + Exonic
1128439271 15:67688966-67688988 GAGCACAGTATCTTGCTCACTGG - Intronic
1130018392 15:80204986-80205008 GACAACAGTAGCTTCCTCTCTGG - Intergenic
1130031955 15:80323811-80323833 AATAACAGTGTCTATCTTACAGG + Intergenic
1130559927 15:84950040-84950062 GCCAACAGAGACTTTGTCACTGG + Intergenic
1131548168 15:93333161-93333183 GACAAGAGTCTCTGTCTCCCAGG - Intergenic
1132238191 15:100237563-100237585 GACAGCAGTGTCTTCCCCACGGG - Intronic
1133909232 16:10049924-10049946 GATAACAGTGGCTTTTCCACTGG - Intronic
1134180977 16:12047569-12047591 GACAATATTATCTTCCTCACAGG - Intronic
1134423621 16:14117301-14117323 CCCACCAGTGTCTTTCTCACTGG - Intronic
1135266795 16:21033683-21033705 GACAAGAGTTTCTCTTTCACTGG + Intronic
1135307715 16:21381330-21381352 GACAATATTATCTTCCTCACAGG - Intergenic
1135664421 16:24324132-24324154 GATGGCAGTGTCTTTCTAACAGG - Intronic
1136304459 16:29360451-29360473 GACAATATTATCTTCCTCACAGG - Intergenic
1137068171 16:35872885-35872907 AACAACAGTTATTTTCTCACAGG + Intergenic
1137497303 16:48980511-48980533 AACAACAGTGCCTATCTCAGTGG - Intergenic
1145203633 17:20968880-20968902 GAGAACATTGCCTGTCTCACAGG - Intergenic
1146483589 17:33225386-33225408 GATAACAGTAACTTCCTCACAGG + Intronic
1146576341 17:33995224-33995246 GACAACAATGTCTTATTCACAGG + Intronic
1146901165 17:36590309-36590331 GACCACAGTGACTTTGTTACTGG - Intergenic
1148785008 17:50141882-50141904 GACAAGAGTGTGATTGTCACAGG - Intronic
1149363450 17:55917174-55917196 GACATCAGGGCCCTTCTCACAGG + Intergenic
1150186985 17:63192549-63192571 CAACACAGTGTCTTCCTCACTGG - Intronic
1151152931 17:72103653-72103675 AACAACATCATCTTTCTCACGGG + Intergenic
1151640162 17:75386484-75386506 ACCAATATTGTCTTTCTCACTGG - Intronic
1152244469 17:79177899-79177921 GACAAATGTGTGTTTCTCAGGGG - Intronic
1153486184 18:5600986-5601008 GACAACAATGTATCTCTAACTGG - Intronic
1154482136 18:14841111-14841133 GACAGTCTTGTCTTTCTCACTGG + Intronic
1155249262 18:23939590-23939612 GACGACAGTGTACTTCTCAGAGG + Intronic
1156028234 18:32681964-32681986 GATAATGGTCTCTTTCTCACAGG + Intronic
1156315636 18:35966512-35966534 GACAACAGTGCCTGCCTCCCAGG + Intergenic
1158520467 18:58168457-58168479 GATAACAGTTTCTTTGTAACTGG + Intronic
1159957132 18:74526632-74526654 GATTACGGTGTTTTTCTCACTGG - Intergenic
1160754119 19:748733-748755 GAGACCAGTGTCATGCTCACGGG + Intergenic
1161113223 19:2481392-2481414 GACAACAGCATCTTCCTCACGGG - Intergenic
1161566772 19:5006891-5006913 GACAACAGTGCCTTTCCCATGGG + Intronic
1162332339 19:10038000-10038022 GCCAACACTGTCTTCCTCATGGG - Intergenic
1164215321 19:23140239-23140261 CACAAAAGTGTTTTTCTCAAAGG - Intronic
1167460031 19:49620278-49620300 GAGAACAGTGTCTGCCACACAGG + Intronic
926355088 2:12034242-12034264 GGCACCAGTGTCCTTCTCATGGG + Intergenic
928116491 2:28548775-28548797 GACTAATGAGTCTTTCTCACTGG + Intronic
930731177 2:54729507-54729529 AGCAACAGTGCCTATCTCACTGG - Intronic
933222542 2:79707108-79707130 GAAAGCAGTGCCTTTCTCAATGG - Intronic
933898318 2:86831538-86831560 GAAAACATTTTCTTTCTCAAAGG - Intronic
933994820 2:87660579-87660601 GACAACAGCGGCTTTCCTACTGG - Intergenic
936144961 2:109974758-109974780 CACAACAGTGTTTTCCCCACTGG + Intergenic
936181647 2:110272721-110272743 CACAACAGTGTTTTCCCCACTGG + Intergenic
936199725 2:110396709-110396731 CACAACAGTGTTTTCCCCACTGG - Intergenic
936230919 2:110698959-110698981 CACAACAGTGTTTTCCCCACTGG - Intergenic
936299037 2:111290334-111290356 GACAACAGCGGCTTTCCTACTGG + Intergenic
937392657 2:121504250-121504272 GAAAAAAGAGGCTTTCTCACAGG + Intronic
937665397 2:124481553-124481575 GAGAACAGTGTTTTCCTCTCTGG - Intronic
938285822 2:130115649-130115671 GAAAATAGTAGCTTTCTCACAGG + Intronic
938373142 2:130786462-130786484 GACAATACTGTCTTATTCACGGG + Intergenic
938429782 2:131223253-131223275 GAAAATAGTAGCTTTCTCACAGG - Intronic
938474604 2:131596435-131596457 GAGAATAGTAGCTTTCTCACAGG - Intergenic
941172278 2:162153912-162153934 GATTACATTGTCTTTCTCTCTGG + Intergenic
942611568 2:177747327-177747349 CAGAACAGGGTCTTTCCCACAGG - Intronic
942738517 2:179145408-179145430 GACAATAGTATCTATTTCACAGG + Intronic
943201121 2:184825612-184825634 GTCAAGAGTTTCTTTCTCAAAGG - Intronic
945097539 2:206233678-206233700 TACCACTGTGTCATTCTCACAGG - Intergenic
948555994 2:238811435-238811457 GAAAACAATGTCTTTATCACTGG - Intergenic
1168873423 20:1151438-1151460 GACAATAGTATCTATTTCACAGG - Intronic
1170369885 20:15637264-15637286 AAGAACAGTGTCTCTCTCATAGG + Intronic
1170732477 20:18986956-18986978 GAGAGCAGTGTTTTTCCCACTGG + Intergenic
1171878604 20:30600095-30600117 GGACACAGTGTCTTTCTCATGGG + Intergenic
1175139194 20:56847214-56847236 GACAAGAGTGTCTGCCTCACAGG + Intergenic
1175193290 20:57225446-57225468 TACAACAGTGTCTTACACACAGG - Intronic
1175400380 20:58696824-58696846 GACAACAGGATGTATCTCACAGG - Intronic
1176069596 20:63219101-63219123 GACAACTGTCTCTCCCTCACAGG + Intergenic
1177636439 21:23793180-23793202 TAGAACAGTGTTTTTCTCCCTGG - Intergenic
1180474965 22:15695028-15695050 GAAAATAGTAGCTTTCTCACAGG - Intronic
1182388443 22:29968244-29968266 GACATTAGTATCTTCCTCACTGG + Intronic
1182458237 22:30466251-30466273 GATAACACTGTCTTTGTCCCAGG - Intronic
1182884004 22:33757841-33757863 GACAACAGTGCATTTCCCAAAGG - Intronic
1183538566 22:38416982-38417004 AACAACAGTCCCTCTCTCACAGG - Intergenic
1185093171 22:48787215-48787237 GATAATAGTGTCATTCTGACAGG + Intronic
949677090 3:6467806-6467828 GATAATAGTTTCTCTCTCACTGG + Intergenic
951940322 3:28070876-28070898 GTCAACAGTGTGTGTCTCTCTGG - Intergenic
953511226 3:43541832-43541854 GATAACAGTGACTTTCACAAAGG + Intronic
953583114 3:44174646-44174668 GGCAACTGTGTCTTCCACACCGG - Intergenic
956846256 3:73185858-73185880 CAGAACAGTGTTTCTCTCACAGG - Intergenic
957639153 3:82827924-82827946 GATAACAGTGTCACTCACACAGG - Intergenic
958989284 3:100823361-100823383 GACAACAGTGTCATTCTTGATGG - Intronic
959477270 3:106826215-106826237 TTCAAGAGTGTCTTTCTCAAGGG - Intergenic
959889220 3:111535046-111535068 AACAACTGTGTTTTTTTCACAGG - Intronic
960978955 3:123203461-123203483 GACAATAGTATCTATCTCATAGG - Intronic
961172034 3:124803943-124803965 AAAAACAATGTCTTCCTCACAGG + Intronic
963153145 3:142068451-142068473 AAAAACAGTGTCTTTCACAGAGG - Intronic
964074811 3:152680817-152680839 GCCAACAGTGTGGTTCTAACAGG - Intergenic
965733416 3:171796211-171796233 CACAACTCTGTCTTTCCCACTGG - Intronic
966048478 3:175584012-175584034 GACAATAGTACCTTCCTCACTGG - Intronic
967872732 3:194245698-194245720 GATAACAGTGCATTCCTCACAGG + Intergenic
967931107 3:194690872-194690894 GCCAACATTGGCATTCTCACAGG - Intergenic
968632415 4:1658866-1658888 GACAGCCGTGTCCTTGTCACAGG - Intronic
968962093 4:3750803-3750825 GACAGCAGTGACTGTCTCAAGGG + Intergenic
969389334 4:6879247-6879269 GACAACAGTACCTACCTCACAGG - Intronic
970088412 4:12374087-12374109 GACAATACTATCTTTCTCACTGG + Intergenic
971369149 4:26001823-26001845 GAAGAGAGTGTCTTTCTCCCCGG - Intergenic
973864500 4:55098292-55098314 AACAACAGTGTGTTTATGACTGG - Intronic
974888440 4:67850345-67850367 GACAAAAATTTATTTCTCACAGG - Intronic
975879395 4:78885364-78885386 GACAGCAGTGTCAGTATCACTGG + Intronic
976667718 4:87617371-87617393 TAGAACAGTGTCTTACTCCCAGG + Intergenic
978624686 4:110671504-110671526 GATAATAGTATCTTTCTCAGAGG + Intergenic
979409575 4:120360195-120360217 GATAATAATGTCTATCTCACAGG - Intergenic
979593374 4:122505937-122505959 AACATAAGTGTATTTCTCACAGG + Intergenic
980115515 4:128675060-128675082 GACTACATTGTCTTTCTTATTGG + Intergenic
981532720 4:145767655-145767677 GATGACAGTGGATTTCTCACTGG + Intronic
982277148 4:153647695-153647717 GAGAACAGAGTCTTTCCAACTGG - Intergenic
983188031 4:164723071-164723093 AATAACAGTGTCTGTGTCACTGG + Intergenic
983976702 4:173943691-173943713 GATAACAGTATCCTTGTCACAGG - Intergenic
984137555 4:175959965-175959987 GATAATAGTTTCTTTCTCATAGG - Intronic
984975760 4:185228847-185228869 GATAACAGTAGCTTTCTCATAGG - Intronic
985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG + Intronic
986625659 5:9721467-9721489 GACACCAGGGACTTTCACACAGG - Intergenic
986906500 5:12500385-12500407 AATAACAGTGTCTGTCTCCCAGG + Intergenic
993237026 5:85324413-85324435 AACAACACTGTCATCCTCACTGG - Intergenic
993622177 5:90181276-90181298 GACAATACTGTCTACCTCACAGG + Intergenic
995418609 5:111937277-111937299 GTCATAACTGTCTTTCTCACTGG + Intronic
995968547 5:117939570-117939592 TACAACAGTGTCTTTCAAACTGG + Intergenic
997469023 5:134106386-134106408 GACAACACTGCCTGTCTCACTGG - Intergenic
998526419 5:142847136-142847158 GATAACAGTGCCTGTCTCATGGG + Intronic
998733207 5:145105122-145105144 GACAATAGAATCTTTCTCATAGG - Intergenic
999123061 5:149224797-149224819 GACAACAGTATCTGCCTCATAGG - Intronic
999293745 5:150444875-150444897 GACAACAGTGTGTGCCACACCGG - Intronic
999331781 5:150678380-150678402 GACAACAATATCTTTCTCTCAGG - Exonic
1000107328 5:158072714-158072736 GAAAACAGTATTTTTCTCACAGG - Intergenic
1000195856 5:158957151-158957173 GATAATAATGTCTATCTCACAGG - Intronic
1000252476 5:159508733-159508755 AACAATAGTGTCTGTCTCATAGG + Intergenic
1000281094 5:159782700-159782722 GACAATAGTGCCTGTCTCATGGG + Intergenic
1001255235 5:170178177-170178199 GACAGCAGTGCCATCCTCACGGG - Intergenic
1002518469 5:179776402-179776424 ACCAGCAGTGCCTTTCTCACTGG + Exonic
1002796480 6:475014-475036 GACACCAGAGGCTTTCTCTCTGG + Intergenic
1003474206 6:6466487-6466509 GACAACAATGTCTAACTCAAAGG + Intergenic
1003707771 6:8553837-8553859 GACAATAATGTCTGTCTTACAGG - Intergenic
1006690423 6:35879063-35879085 GACAAGAGTCTCTGTCACACAGG - Intronic
1007258082 6:40542525-40542547 GGCAGCAGTGGCTTCCTCACTGG + Intronic
1007931887 6:45699123-45699145 GTCAAAAGTCTCTTTCTCAAAGG - Intergenic
1008394312 6:50989354-50989376 GACAACAGTTTCTTTGGAACTGG + Intergenic
1008483750 6:52013268-52013290 GAAAACAGTGTGTTCCTAACAGG - Intronic
1010346997 6:74823701-74823723 GAAAGCTGTGTCTTTCTCACTGG - Intergenic
1011335112 6:86251593-86251615 GAAAATATTGTCTTTCTCCCAGG - Intergenic
1013520410 6:110927524-110927546 GATGACAGTGTCTTCCTCATGGG + Intergenic
1013813253 6:114067929-114067951 GATAATAATGTCTATCTCACAGG + Intronic
1016140511 6:140603309-140603331 GAGAATGGTGCCTTTCTCACGGG + Intergenic
1016626705 6:146179002-146179024 GACCACTGTCTATTTCTCACAGG - Intronic
1016656503 6:146524326-146524348 TAGAACAGTGCCTGTCTCACAGG + Intergenic
1018394998 6:163371399-163371421 GACAGCTTTGTCTTTATCACTGG - Intergenic
1019909655 7:4092142-4092164 AATAACAGTGCCTGTCTCACGGG + Intronic
1020359768 7:7315652-7315674 GAGTACAGTGGGTTTCTCACTGG + Intergenic
1022057431 7:26753242-26753264 CACAAGAGTGTCTTTTTCACTGG + Intronic
1022163571 7:27736073-27736095 CACAACAGTGTATATCTCAAAGG + Intergenic
1022262454 7:28719590-28719612 AAAAACAGTGTCTATCTCACAGG - Intronic
1022487099 7:30787516-30787538 CACAACAGTGTCCTGCTCTCAGG - Intronic
1024990042 7:55226322-55226344 CACCACACTGTCTTTCTCAATGG + Intronic
1025067697 7:55872082-55872104 TACAACAGTGGCTTTCTAGCGGG - Intergenic
1028086253 7:86641187-86641209 GAGAACAGTGCATTTCTGACTGG + Intergenic
1028699466 7:93760488-93760510 GACCACATTGTTTTCCTCACTGG + Intronic
1028859368 7:95631301-95631323 AAGAACAGTGTCTGTCTCACAGG - Intergenic
1034126709 7:148678034-148678056 GCCAGCAGTGTATTTCTCAGTGG + Intergenic
1034218036 7:149422804-149422826 CACAACCGTGTCGGTCTCACTGG - Intergenic
1034680053 7:152921779-152921801 GACAACAGCGTCCATATCACAGG - Intergenic
1035479519 7:159170952-159170974 CACACCAGTGTCCTGCTCACAGG - Intergenic
1037681381 8:21100558-21100580 GACAGCAGTGTCTGTCTCGGTGG + Intergenic
1038510879 8:28134156-28134178 AAGAACAGTGTGTTTCACACTGG - Intronic
1041082048 8:54223281-54223303 GATAATAGTGTCTATCTCAGAGG + Intergenic
1041540519 8:58979841-58979863 GACAATAGTGCCTATCTCATGGG + Intronic
1042005175 8:64171768-64171790 GATAAAAATGTCTTTCTCATGGG + Intergenic
1042800438 8:72712318-72712340 GATAGTAGTGTCTTACTCACAGG + Intronic
1046102315 8:109629393-109629415 GACAACAGTGCTTATCTCAGAGG - Intronic
1047022775 8:120793911-120793933 GCTCACAGTGTCTTTCTCAATGG + Intronic
1047643368 8:126844361-126844383 GGTAACAGTGTCTAACTCACGGG + Intergenic
1051066661 9:13112544-13112566 GACAACAGTGCCTCTCACAGAGG + Intronic
1057265863 9:93617315-93617337 GGACACAGTGGCTTTCTCACGGG - Intronic
1058851518 9:109015755-109015777 GATAATATTGTCTGTCTCACAGG + Exonic
1059761651 9:117343576-117343598 AATAATAGTGTCTATCTCACAGG - Intronic
1060544901 9:124453888-124453910 GGCAACAGTGTCCCTCTCTCAGG + Intronic
1061497722 9:130985127-130985149 GACAACAATGTCTAATTCACAGG - Intergenic
1061533185 9:131230600-131230622 GACCTCAGTCTGTTTCTCACTGG + Intronic
1062120275 9:134830358-134830380 GACAAGAGTGTGTTTCTGCCTGG + Intronic
1185833079 X:3320066-3320088 GAACACAGTGTCTGTCTCAGCGG + Exonic
1186718927 X:12281748-12281770 GAGCACAGTGTCTTTCACAGAGG - Intronic
1187043944 X:15626641-15626663 GACCACAGTTTCTTTCACATGGG + Intergenic
1188870720 X:35367619-35367641 GACAACAGCAACTTTGTCACAGG - Intergenic
1189662206 X:43312076-43312098 GACATCATTTTTTTTCTCACAGG + Intergenic
1191760424 X:64642304-64642326 GACAACAGTCACATTCTCAAGGG - Intergenic
1192143693 X:68666151-68666173 GACAACTGTATCCTTCTCAATGG - Intronic
1194734406 X:97495083-97495105 GCCCACAGTTTCTTTCTCAGGGG - Intronic
1196231089 X:113222519-113222541 GACATCTGTGACTTTCTCACGGG + Intergenic
1196796228 X:119503864-119503886 GACAACAGTGGCTTTTCCATGGG - Intergenic
1198005709 X:132490272-132490294 AACCACACTGCCTTTCTCACTGG - Intergenic
1200790266 Y:7293204-7293226 GACAGCATTGTGTTCCTCACAGG - Intergenic