ID: 1105914854

View in Genome Browser
Species Human (GRCh38)
Location 13:24904228-24904250
Sequence AAATTCCCACTGATTTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105914854_1105914857 21 Left 1105914854 13:24904228-24904250 CCTGAGGAAATCAGTGGGAATTT 0: 1
1: 0
2: 1
3: 27
4: 210
Right 1105914857 13:24904272-24904294 AAAAGAGTATCGACCTGACAAGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105914854 Original CRISPR AAATTCCCACTGATTTCCTC AGG (reversed) Intronic
906476558 1:46173183-46173205 GTATTCCCTCTGATTTCCTCAGG + Intronic
907918733 1:58894072-58894094 GAATTGTCACTGTTTTCCTCTGG + Intergenic
908746327 1:67380091-67380113 AAATTCCCTCTCATTTCCGTGGG - Exonic
908949494 1:69542811-69542833 ATATTGCCACTGATCTCATCAGG - Intergenic
910108530 1:83657146-83657168 CAGTTTCCACTGATTCCCTCAGG + Intergenic
910261701 1:85299257-85299279 AAAATACCACTGATTGCCTTAGG + Intergenic
910490728 1:87766754-87766776 ATTTTCTAACTGATTTCCTCAGG + Intergenic
910756028 1:90691789-90691811 AAAAGCCCACTGATTGACTCAGG - Intergenic
911416574 1:97582272-97582294 CACTGCCCACAGATTTCCTCAGG - Intronic
914818739 1:151083211-151083233 ATATTACCACTTATTTCATCAGG + Intronic
917203125 1:172538516-172538538 AAATTCCTCCAGATTTCCTGGGG - Intronic
917731759 1:177881607-177881629 AAATTCCTTCTGAATTTCTCAGG - Intergenic
918567100 1:185947324-185947346 AAATTCCAAATGAGTTCCTTGGG - Intronic
918827560 1:189345455-189345477 AGATTAACACTTATTTCCTCTGG + Intergenic
920710149 1:208287254-208287276 GCATTTCCACAGATTTCCTCTGG + Intergenic
921218349 1:212955535-212955557 GAATGCCCACTGTTTTCTTCTGG - Intronic
924028398 1:239863025-239863047 AAACTCCTCCTGATATCCTCAGG - Intronic
1063251313 10:4278416-4278438 AAAATCCCACTGCTTTTCTCAGG - Intergenic
1064362761 10:14680683-14680705 AAATTCCCACTAACTTCCTCTGG + Intronic
1069362829 10:67662964-67662986 AAGTTTCCACTGATATCCTTTGG + Intronic
1070690450 10:78521108-78521130 CAAAGCCCTCTGATTTCCTCGGG - Intergenic
1070924229 10:80207566-80207588 AAATTCACACAGATTTCTTGGGG - Intergenic
1073120290 10:101118333-101118355 AAACTCCCACTTTTGTCCTCAGG - Intronic
1074171407 10:110942208-110942230 ATAATTCCACTGATTTCGTCAGG + Intronic
1075499472 10:122959562-122959584 CAGTTCCCACAGATTTCCACTGG - Intronic
1075729192 10:124626274-124626296 AGCTTCCCACTGACCTCCTCTGG + Intronic
1075869700 10:125762062-125762084 CAATTCCCACTTATTTTATCAGG - Intronic
1076627846 10:131832802-131832824 GAATTCTCACTAATTTCCTTAGG + Intergenic
1079432543 11:20407554-20407576 AAATTCCCACTGAAACCATCTGG + Intronic
1083529430 11:63405697-63405719 AAACTCCCAGTGAGTACCTCAGG - Intronic
1086167963 11:83801418-83801440 AAATTCAAACTCCTTTCCTCGGG + Intronic
1087292925 11:96339839-96339861 AACCTCCCACTGCTTTCCTAGGG + Intronic
1089474109 11:118744435-118744457 TCCTTCCCACTGATTTCCTGGGG + Intergenic
1089818406 11:121198214-121198236 AAATTCAAACTTTTTTCCTCAGG - Intergenic
1092665765 12:10795601-10795623 AAATTTTCTCTGATTTCCACAGG + Intergenic
1093974490 12:25405993-25406015 AATTTCCCACTGAAATCATCAGG - Intergenic
1094390226 12:29940895-29940917 ATCTTTTCACTGATTTCCTCTGG + Intergenic
1094460445 12:30692522-30692544 AATTTCTCAATGATTTCCTGAGG + Intronic
1095218670 12:39581383-39581405 AAATGAACAGTGATTTCCTCTGG - Intronic
1095822555 12:46494524-46494546 AAAATCCCAATGGTTTCTTCAGG + Intergenic
1097957854 12:65504992-65505014 ATATTCACAGTGATTTTCTCTGG - Intergenic
1098468959 12:70822381-70822403 TAATTTCCACTGTCTTCCTCTGG - Intronic
1098848867 12:75570695-75570717 AAATTACCAATGTTTGCCTCTGG + Intergenic
1100047048 12:90395341-90395363 AATTTACCAGTGTTTTCCTCTGG - Intergenic
1100122528 12:91385225-91385247 TAATTCCAATTGATTTCCTGTGG - Intergenic
1100179619 12:92071352-92071374 AAATTGCTACTGGTTTCCCCAGG - Intronic
1104263787 12:127211660-127211682 AAATTCCCAATTAATTCTTCAGG + Intergenic
1105914854 13:24904228-24904250 AAATTCCCACTGATTTCCTCAGG - Intronic
1106462260 13:29981488-29981510 AAATGCACACTGAGTTCCTCTGG + Intergenic
1108830941 13:54477412-54477434 AAATTCCCATTGACTTCACCTGG - Intergenic
1109483253 13:62984682-62984704 GAAGTACCACTGACTTCCTCAGG + Intergenic
1109872868 13:68358603-68358625 TTATTGCCACTGATTTCCTCAGG - Intergenic
1110655798 13:77997259-77997281 AAATTCCCACAGACTTCTTATGG + Intergenic
1111718929 13:91917273-91917295 AAGTTCCCAATGATCTCCTTTGG + Intronic
1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG + Intergenic
1116086522 14:40246155-40246177 AATTTCCCACTCATATCCTCTGG - Intergenic
1117311559 14:54529465-54529487 GAATCCCCACTCTTTTCCTCAGG + Intronic
1117512161 14:56463455-56463477 GAATTCCCACTGCTCTCCTTTGG - Intergenic
1117632434 14:57707969-57707991 AAATACCCCCTTATTTCCTAGGG + Intronic
1119467247 14:74868226-74868248 AAATTTTAACTGATTTTCTCTGG - Intronic
1119964492 14:78899056-78899078 AGAGTCCCACTGCTTTTCTCTGG - Intronic
1120901255 14:89577566-89577588 AAATTCCCCGTGATTGCCCCGGG - Intronic
1121877181 14:97464102-97464124 AAATTGCCACTATTTTCTTCAGG - Intergenic
1123756192 15:23399357-23399379 AAGGGCCCACTGATTTCCTCTGG - Intergenic
1123812852 15:23946385-23946407 AACTTCCCATTGATATCTTCAGG + Intergenic
1123817874 15:23998092-23998114 ACATTCCCAGTTATTTCATCAGG + Intergenic
1125454543 15:39844147-39844169 AAAATTCCCCTGATATCCTCCGG + Intronic
1125583567 15:40804662-40804684 GACTTCCAACTGACTTCCTCAGG + Intronic
1126647028 15:50884869-50884891 AAATTCCCATTGTTTCCTTCTGG + Intergenic
1127138738 15:55952469-55952491 AAATTTCTCCTGTTTTCCTCGGG + Intronic
1127251768 15:57246268-57246290 AAATCCCCAGTGTTTTCCTTGGG + Intronic
1127305283 15:57699946-57699968 TTATTCCCACTGACTTCATCTGG + Intronic
1133367101 16:5218668-5218690 CAATTCACAGTGATTTCTTCTGG - Intergenic
1133461443 16:5989933-5989955 AAAATCTCACTGGCTTCCTCTGG - Intergenic
1134460142 16:14423364-14423386 AAGGGCCCACTGGTTTCCTCTGG + Intergenic
1135427212 16:22348631-22348653 AAATACCAACACATTTCCTCAGG - Intronic
1135794995 16:25433171-25433193 AATTACCCACTGATATCCACTGG - Intergenic
1136187219 16:28595549-28595571 AAAGTCCCAGGGATTCCCTCAGG - Exonic
1137858445 16:51820572-51820594 AAAAACTCATTGATTTCCTCAGG - Intergenic
1138366788 16:56485738-56485760 AAATTTCTACTGATTTGCACAGG - Exonic
1139008975 16:62609068-62609090 TGATTCCAAATGATTTCCTCAGG - Intergenic
1139085443 16:63579638-63579660 AAATTGCCCCTAATTTCCACTGG - Intergenic
1140431933 16:74911529-74911551 AGATTCCACCTGATTTGCTCTGG + Intronic
1141272551 16:82554450-82554472 AAATCCCCATTCTTTTCCTCTGG - Intergenic
1144319211 17:14097157-14097179 AACTTTCCATTGATTTCCTGGGG - Intronic
1144720677 17:17467752-17467774 CAATTCCCGCTCACTTCCTCAGG - Intergenic
1147675268 17:42201004-42201026 GAATTGCCACTCAGTTCCTCTGG - Exonic
1148438614 17:47700406-47700428 ACATTCCCTTTGCTTTCCTCTGG + Intronic
1149018789 17:51939048-51939070 ACTTTCACACTGGTTTCCTCAGG - Intronic
1152885622 17:82847388-82847410 AAAACCCCACTGATGTTCTCAGG - Intronic
1153985487 18:10347166-10347188 AAACTCCCAAGGATTTCTTCGGG - Intergenic
1155255476 18:23994343-23994365 AAATACAGACTGATTTCCTTTGG - Intronic
1155735076 18:29211448-29211470 AAATTCCTACTGTTCTCATCTGG - Intergenic
1156948697 18:42867114-42867136 AATCTCCCACTGATTTGCTTTGG + Intronic
1157076594 18:44473888-44473910 TCATTCCCATTGATTGCCTCTGG + Intergenic
1157437477 18:47683035-47683057 ACCTTCCCACTGAGATCCTCTGG + Intergenic
1158318207 18:56235497-56235519 AAACTCCCATTCATTTCCTCGGG - Intergenic
1160431460 18:78815860-78815882 AAATTCCTTCTGGTTCCCTCAGG - Intergenic
1163946333 19:20538657-20538679 CAATTCCCCCTGAATTACTCAGG - Intronic
1164743224 19:30592315-30592337 AAAATCCCACTGCATTCCTGGGG - Intronic
1165930337 19:39353984-39354006 ATATTCCCATTCATTTCTTCAGG + Exonic
1166974124 19:46593725-46593747 AATTCCCCAATGATTTCTTCTGG + Intronic
1167308804 19:48724391-48724413 ACATTGCCACTGAGTTCTTCCGG - Exonic
925215195 2:2088352-2088374 GAATCCTCACTGAATTCCTCAGG - Intronic
925788245 2:7453946-7453968 AAGTTCCCACTGAATGCTTCTGG + Intergenic
929263683 2:39894893-39894915 AGTTTCATACTGATTTCCTCTGG - Intergenic
929584429 2:43104959-43104981 ACACTCCCACTGCTTCCCTCAGG - Intergenic
931923373 2:67044777-67044799 AAATTCCAACAAATCTCCTCAGG - Intergenic
933658373 2:84906968-84906990 AAAGCCCCACTGTTTCCCTCTGG + Intronic
933866439 2:86522488-86522510 AAATAGCCACTGATTTCCTGGGG + Intronic
938006694 2:127792968-127792990 ACATTACCACAGATTGCCTCTGG + Intronic
938856400 2:135316413-135316435 AAATTCCCAATCATCTCCTAGGG + Intronic
939546538 2:143561382-143561404 AAATTCCCAGTCAGTTCTTCCGG - Intronic
939622643 2:144439087-144439109 AAACTCCCATTTATTTGCTCAGG + Intronic
941759693 2:169228274-169228296 AAATTACCACTCATTTCATTTGG + Intronic
942239480 2:173946493-173946515 CATTTCCAACTCATTTCCTCAGG + Intronic
945403624 2:209420182-209420204 AAATTACCATTGACTTCTTCTGG - Intergenic
945674784 2:212843048-212843070 AAATTCCCACTGATGTCATTAGG + Intergenic
946677008 2:222170920-222170942 AAATTCTCCCTGACTTCCTGGGG - Intergenic
946681172 2:222217978-222218000 AAATTCCTCCTTATTTCCTCAGG - Intronic
947400998 2:229731496-229731518 AAATTCCCACTGATGATCTCAGG - Intergenic
1169002821 20:2180332-2180354 AAAACCTCAGTGATTTCCTCCGG + Intergenic
1174735879 20:52965291-52965313 AAATTCACATTTATATCCTCAGG - Intergenic
1176518701 21:7807999-7808021 AAATTCAGACTGATTGGCTCTGG + Intergenic
1177460813 21:21407414-21407436 AAATTCACACTGAGATCATCAGG + Intronic
1178652729 21:34438012-34438034 AAATTCAGACTGATTGGCTCTGG + Intergenic
1181992390 22:26847307-26847329 CAATTTCCAGTGATTTCCTTGGG + Intergenic
1182939527 22:34261984-34262006 AAAATCCCTCTGCTTCCCTCAGG - Intergenic
949148833 3:739635-739657 AAATTCCCTCAGATTTTATCTGG + Intergenic
950366549 3:12489545-12489567 AGATTACCACTCATTTCCTGGGG + Intronic
952220792 3:31322070-31322092 AAAGCCCAACTGATTTCCTGTGG - Intergenic
953129671 3:40125901-40125923 AAATTCCCAGTGACATACTCAGG + Intronic
953367144 3:42354510-42354532 CTGTTCCCAGTGATTTCCTCGGG - Intergenic
960210558 3:114960017-114960039 ATATTCCCACTGTTTGCCTTTGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962377352 3:134869411-134869433 TATTTCCCACTGAATTCCCCCGG - Intronic
962857937 3:139366459-139366481 AATTGCCAACTGATTTCCTGTGG - Intronic
963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG + Intronic
963629691 3:147717552-147717574 AAATTGACCTTGATTTCCTCTGG + Intergenic
964574738 3:158153043-158153065 AAACTCCACCTGCTTTCCTCAGG - Intronic
965599569 3:170441827-170441849 AAATTCCCTCTGAAATCCTCAGG - Intronic
966905954 3:184525892-184525914 GAATACCCACTGATTGCCCCCGG - Intronic
967373775 3:188778120-188778142 ATATTCCAACTGTTTTCCACTGG + Intronic
967475379 3:189910510-189910532 AAATTTCCACTGTTTACCTTGGG - Intergenic
967916521 3:194582573-194582595 AGAATCCCTCAGATTTCCTCTGG + Intergenic
969558358 4:7929202-7929224 AAAGTACAACTGAGTTCCTCAGG + Intronic
970105728 4:12581082-12581104 ACATGCCAAGTGATTTCCTCAGG - Intergenic
970110879 4:12636849-12636871 AAGATTCCACTGAATTCCTCAGG + Intergenic
970232364 4:13923888-13923910 AAATTGCCACTGATTGACTCAGG - Intergenic
970685103 4:18558703-18558725 AAAATGCCACTGTATTCCTCAGG + Intergenic
972636413 4:40887915-40887937 TAATTCACACTGATTTCATCAGG + Intronic
976670636 4:87648945-87648967 AAATTCCCTGTGATTTGCTCTGG - Intergenic
976721961 4:88177875-88177897 AAATTCCCTCTGGTTACCTCTGG - Intronic
977356779 4:95955591-95955613 AAGTTCCCTCTGATTTCCGCAGG - Intergenic
978483908 4:109228188-109228210 AGACTCACACTAATTTCCTCTGG + Intronic
978682792 4:111402650-111402672 TCATGCCCACTGATTTTCTCTGG + Intergenic
979510969 4:121553223-121553245 GAATTCCCACTGAATACCTTGGG - Intergenic
979806162 4:124973829-124973851 GTATTGACACTGATTTCCTCTGG + Intergenic
980765693 4:137301161-137301183 AAGTTCTCATTGATTTCCACGGG + Intergenic
982748572 4:159131901-159131923 AACTTCCCACACATTTCCTCTGG - Intronic
988938462 5:36116057-36116079 AAATCCTCTCTGAATTCCTCAGG + Intronic
989177668 5:38544503-38544525 AAATTAACACTCACTTCCTCAGG + Intronic
989352054 5:40497891-40497913 ACATTCCAACTGAATTCCTTTGG + Intergenic
990209971 5:53471824-53471846 ATATTCCCATGGATTTCCTCTGG + Intergenic
991431593 5:66553570-66553592 GAATTCCAACTGAATTCTTCTGG - Intergenic
993752487 5:91688204-91688226 AAATTATCATTGATTTCCTGAGG + Intergenic
994346771 5:98696764-98696786 CAACTCCCACTGATGTTCTCTGG - Intergenic
995382591 5:111551253-111551275 GAATTCCCACCCATTTCCTCAGG + Intergenic
997018392 5:129965047-129965069 AAATTCCAACTGATGTCATGAGG - Intronic
998200943 5:140119843-140119865 ATATTCCCACTCATTTTTTCAGG + Exonic
999258143 5:150221355-150221377 AAATTCCCAGTGCTTTGCTGTGG + Intronic
1000188889 5:158889015-158889037 AAGTTCCCACTGATTACTTTAGG + Intronic
1000266277 5:159641081-159641103 AAATTCCCACTCTGTTCCACTGG - Intergenic
1000417724 5:161000445-161000467 AATTTCCCAATGTTTTCTTCTGG + Intergenic
1000737324 5:164921007-164921029 AAATTTCCACAGATTTCATTTGG - Intergenic
1001244471 5:170095615-170095637 AAATTCCCACTGATGTGCAGAGG + Intergenic
1004101716 6:12618998-12619020 AAATTGACAATGATTACCTCTGG + Intergenic
1005234415 6:23743253-23743275 TAATTGCCACTGAATTCCTAGGG + Intergenic
1006900654 6:37498864-37498886 AAAGTCCTACTGAATTACTCGGG + Intronic
1007296106 6:40822112-40822134 GGATTCCCACTGATTTTTTCTGG + Intergenic
1008364046 6:50655011-50655033 AAAAACTCACTGATTACCTCAGG - Intergenic
1008797403 6:55321032-55321054 AAACTGCCACTGTTTTCCTGTGG + Intergenic
1009884969 6:69615116-69615138 AAATTCTCATTGATCTCCTTTGG + Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1010874277 6:81082199-81082221 GATTTCCCAGTGAGTTCCTCTGG + Intergenic
1011234933 6:85205722-85205744 ACTTTCACACTGATTTCATCAGG - Intergenic
1011750048 6:90446535-90446557 AAAATCCAACTAATTGCCTCTGG + Intergenic
1015036991 6:128667992-128668014 AAATTGCCACTGATACCCTTTGG + Intergenic
1016161286 6:140883817-140883839 AAGTTCCCACAGATTAACTCAGG - Intergenic
1016334018 6:142984367-142984389 AAATTCCCACTGTTTGGCTGGGG + Intergenic
1017699590 6:157055566-157055588 AAATTCTTACAGATCTCCTCTGG + Intronic
1018637583 6:165877392-165877414 ACATTACTACTGCTTTCCTCTGG + Intronic
1018965821 6:168488183-168488205 AAAATCCCACTGGTCTCCTCTGG + Intronic
1019010844 6:168842417-168842439 AAATACCTACTTATTTCCACTGG + Intergenic
1021976104 7:26012464-26012486 TAATTCCCAGTGATGTCCCCTGG - Intergenic
1022164644 7:27745387-27745409 TAATTCCCACATAGTTCCTCTGG - Intronic
1022349631 7:29555538-29555560 AAATTGCCACTGCTTACCTCTGG + Intergenic
1023096539 7:36666536-36666558 AAATTTCTATTGATTTCCTATGG + Intronic
1024907028 7:54394814-54394836 AAATCCCCTGTGATTTCATCTGG + Intergenic
1028309822 7:89317382-89317404 AAATTGAGAGTGATTTCCTCTGG + Intronic
1030344782 7:108420675-108420697 TGGTTCCTACTGATTTCCTCTGG + Intronic
1030711787 7:112758310-112758332 AAATCCCCATTGCTTTCATCTGG + Intergenic
1032661585 7:133989842-133989864 AAATTCGCGCTGTTCTCCTCAGG - Intronic
1034594066 7:152171438-152171460 AAATTGCCACTGTTCTTCTCTGG - Intronic
1037106164 8:15111218-15111240 CAATTCGCGCTGATTTCCTAGGG + Intronic
1037446211 8:18968431-18968453 GAATTCCAAATGATTTGCTCAGG - Intronic
1037804251 8:22050350-22050372 AAAATCCCTCTGATTTCCGCAGG + Intronic
1037958691 8:23079503-23079525 AAAATGCCACTGATTTTCTTTGG - Intergenic
1039266639 8:35831689-35831711 AAATTCCTACTGCTTACCTTTGG + Intergenic
1040286577 8:46103585-46103607 AAAGTCCCACTGAGTCCCTGGGG + Intergenic
1040294818 8:46143723-46143745 AACAGCCCCCTGATTTCCTCAGG + Intergenic
1040325212 8:46338160-46338182 AAAGTCCCTCTGAGCTCCTCTGG - Intergenic
1040336952 8:46420902-46420924 AACTTCCCCCTGAGTTCCTGCGG - Intergenic
1040590377 8:48787436-48787458 GCATACCCACTGACTTCCTCAGG + Intergenic
1042175978 8:66037223-66037245 AGTTTCCCACTGATGCCCTCTGG + Intronic
1043522749 8:81063886-81063908 AAATTCCTCCTCATTTCCTCTGG - Intronic
1047118551 8:121873387-121873409 AATTTCCCACTTAGTTGCTCTGG + Intergenic
1048514911 8:135097405-135097427 AACTTCCCATAGGTTTCCTCTGG - Intergenic
1048619610 8:136117518-136117540 AGAATCCATCTGATTTCCTCAGG + Intergenic
1051357483 9:16253210-16253232 GAATTCCCACTGATTTACCAGGG - Intronic
1052439100 9:28470455-28470477 ACTTTCCCAGTCATTTCCTCTGG - Intronic
1053528967 9:38859311-38859333 AAATTCCCAGATACTTCCTCTGG - Intergenic
1054201195 9:62083746-62083768 AAATTCCCAGATACTTCCTCTGG - Intergenic
1054637164 9:67504618-67504640 AAATTCCCAGATACTTCCTCTGG + Intergenic
1055735186 9:79320880-79320902 AAATTCTCAGTCATTTCTTCTGG + Intergenic
1056247182 9:84706894-84706916 AAAGTCTCATTGACTTCCTCCGG + Intronic
1056527014 9:87452929-87452951 AAATGGCCACTGTTTTTCTCTGG + Intergenic
1059821204 9:117974052-117974074 AAATAGCCACTTATGTCCTCTGG - Intergenic
1187309615 X:18129299-18129321 AAACTCCCACTTTTTTACTCAGG + Intergenic
1187624461 X:21094875-21094897 ATCGTCACACTGATTTCCTCAGG - Intergenic
1188545888 X:31306489-31306511 AATTTCCCACAGATTTCCTTAGG + Intronic
1193274492 X:79570174-79570196 CCATTCCCACTGATGTTCTCTGG - Intergenic
1193405597 X:81097324-81097346 AAATTCCTACAGAATTTCTCAGG + Intergenic
1195480406 X:105338405-105338427 AAATTCCTTTTGATTTCCTCTGG + Intronic
1197813719 X:130475114-130475136 AAATGCCCACTGACTTCACCAGG - Intergenic
1198483160 X:137059440-137059462 GTATCCCAACTGATTTCCTCTGG - Intergenic
1198569255 X:137937782-137937804 AAACTTCCACTGATTCCCTAGGG - Intergenic
1199792513 X:151168548-151168570 AAAGTTCCAGTGATTTCCTTTGG + Intergenic
1199824354 X:151483753-151483775 AAATTCCCTCAGATGTCCTATGG + Intergenic