ID: 1105915853

View in Genome Browser
Species Human (GRCh38)
Location 13:24915180-24915202
Sequence AAGATCCTATTGATCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105915853_1105915857 3 Left 1105915853 13:24915180-24915202 CCTCCAGAGATCAATAGGATCTT 0: 1
1: 0
2: 2
3: 40
4: 140
Right 1105915857 13:24915206-24915228 CCTCATTTCTTAAAATTTCCTGG 0: 1
1: 0
2: 2
3: 37
4: 314
1105915853_1105915858 15 Left 1105915853 13:24915180-24915202 CCTCCAGAGATCAATAGGATCTT 0: 1
1: 0
2: 2
3: 40
4: 140
Right 1105915858 13:24915218-24915240 AAATTTCCTGGCTGAGCACCTGG 0: 1
1: 0
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105915853 Original CRISPR AAGATCCTATTGATCTCTGG AGG (reversed) Intronic
901380632 1:8871510-8871532 AAGAGGCTGATGATCTCTGGAGG + Intronic
904156916 1:28491513-28491535 TAGACACTATTGATCCCTGGAGG - Intronic
906669414 1:47643736-47643758 AAGATCCTTTTGGTTCCTGGTGG - Intergenic
917187656 1:172378709-172378731 AAGATTAGATTGTTCTCTGGAGG + Intronic
918694014 1:187520071-187520093 AAGTTCTCATTGATCTTTGGTGG + Intergenic
919265071 1:195252282-195252304 AACATCCTGATGATCTCAGGTGG + Intergenic
923191058 1:231621228-231621250 AAGATCCTAGTGAGCTCAGTAGG - Intronic
923905670 1:238381391-238381413 AAAATGATATTAATCTCTGGTGG - Intergenic
1063864589 10:10350425-10350447 AAGATCCTACTGGCATCTGGGGG + Intergenic
1063927914 10:10998602-10998624 AACTTGCTGTTGATCTCTGGGGG + Intergenic
1064394683 10:14972102-14972124 AAGAATCCATTGAACTCTGGAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1073576127 10:104626341-104626363 AATATCCTTTTGATGTCTGCAGG - Intergenic
1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG + Intergenic
1074342324 10:112645236-112645258 ATGATCTTATTGAATTCTGGGGG - Intronic
1074546545 10:114405371-114405393 AAGAACACATAGATCTCTGGGGG - Intergenic
1075548741 10:123376611-123376633 AAGTCCTTATTGATCTCTGGTGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1081699553 11:45144542-45144564 AAGATCTTTTTGCTCTCTGGAGG + Intronic
1082103470 11:48193903-48193925 AAGATCCTTTTTATCTCTTGTGG + Intergenic
1082863074 11:57873772-57873794 CATCTCCTCTTGATCTCTGGTGG + Intergenic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1087410275 11:97782920-97782942 AATATCCTGTTGATTTGTGGTGG + Intergenic
1088075797 11:105847051-105847073 AAGATCCTGATGATCTGAGGTGG - Intronic
1088075816 11:105847167-105847189 AAGATCCTGATGATCTGAGGTGG - Intronic
1089968782 11:122675684-122675706 TACATCCTGTTTATCTCTGGGGG - Intronic
1091529926 12:1344410-1344432 AAGAAGCTGTTGATCTCTGAAGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092621649 12:10278099-10278121 ATGATCCTATTGTTTTCTGGAGG + Intergenic
1092699481 12:11211898-11211920 AAGAAGCTATTGATCTATGAAGG + Intergenic
1094739193 12:33269350-33269372 AAAATACTAGTTATCTCTGGTGG + Intergenic
1095318352 12:40794132-40794154 ATGATCCTATTTATCTCAGTTGG - Intronic
1097574290 12:61372160-61372182 AAGATTCTATTTGTATCTGGTGG + Intergenic
1099296906 12:80839618-80839640 AAGATCTTATTTATCTGTGTCGG - Intronic
1104734170 12:131126641-131126663 AAGATCACGGTGATCTCTGGTGG - Intronic
1104798824 12:131539174-131539196 AGGTCCCTATTGATGTCTGGTGG + Intergenic
1105915853 13:24915180-24915202 AAGATCCTATTGATCTCTGGAGG - Intronic
1107176260 13:37402658-37402680 AAGAACCTATTGATATGTGTAGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108156878 13:47594301-47594323 AAGATACTAGTGACCTCTGAAGG - Intergenic
1109044824 13:57396450-57396472 AAAATCTTATAGATTTCTGGTGG - Intergenic
1112658619 13:101480949-101480971 CTGCTCCTATTGATCTCTGAAGG - Intronic
1114291905 14:21295399-21295421 AAGATCGTATTGATCCCTGCAGG + Intronic
1115043941 14:28966500-28966522 AAGATCCTTTTCACCTCTTGTGG - Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1117582968 14:57171498-57171520 AAGAGCCTGTTGATGTCTGCTGG + Intergenic
1120043021 14:79775088-79775110 AAGATAGTATTGATCTGGGGTGG + Intronic
1120116231 14:80620740-80620762 AAGATCCTCTTAATATCTGAGGG + Intronic
1128859487 15:71054206-71054228 AACATCCTATTCATCTCTTTGGG + Intergenic
1136380598 16:29892974-29892996 AAGATCCTTCTGACTTCTGGGGG - Intronic
1139101998 16:63778938-63778960 GATACACTATTGATCTCTGGAGG + Intergenic
1140671208 16:77280891-77280913 AAGATACTATTGTTCTTTGTTGG - Intronic
1143672197 17:8404742-8404764 AGGACCCCAGTGATCTCTGGGGG - Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1150455140 17:65301254-65301276 CAGATCCTGATGATCTCTGGGGG - Intergenic
1150793217 17:68216517-68216539 AAGATCCTATGGCTCTTAGGAGG + Intergenic
1151249328 17:72821414-72821436 AAGAACCGATTGAACTCAGGAGG + Intronic
1153154801 18:2135993-2136015 AAGCTCCTATTCATTTCTAGTGG - Intergenic
1157741741 18:50099581-50099603 AAGATCCTTGTGTTCTGTGGTGG - Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1165122620 19:33570356-33570378 CTGATCCTTTTGACCTCTGGGGG + Intergenic
929301212 2:40305380-40305402 AAGATGCTATTGATACCTAGTGG - Intronic
930816399 2:55602515-55602537 AAGATATTCTTGACCTCTGGAGG + Intronic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932048610 2:68376484-68376506 ATGATCCTATAGACCTCTGCAGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
933127875 2:78634022-78634044 AAGAAACTATTAATTTCTGGTGG - Intergenic
933880200 2:86662037-86662059 AAAATACTATTGAATTCTGGAGG + Intronic
934922634 2:98358412-98358434 AAGATCTTATATTTCTCTGGGGG - Intronic
936303965 2:111324243-111324265 AAGAGCCCTTTGATCTGTGGTGG - Intergenic
940596422 2:155799231-155799253 AAGATCATATTAATTCCTGGGGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
945929108 2:215837312-215837334 ATGATTATATTGGTCTCTGGAGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1168928496 20:1602253-1602275 ATGATCCTTTTGATGTCTGCAGG - Intronic
1169399690 20:5269422-5269444 AGGATTCTATTGAGCTCTGAGGG + Intergenic
1170572169 20:17638507-17638529 AAGATCCCATTGAATCCTGGCGG - Intronic
1170749777 20:19135312-19135334 AATATCAATTTGATCTCTGGAGG - Intergenic
1171092774 20:22301700-22301722 AAGATCCAATTGTTCTCTTATGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173033793 20:39389243-39389265 AAGATGCTATTGACCTCCAGTGG + Intergenic
1175406662 20:58737575-58737597 ATGATCCTTTTGATGTCTGTAGG - Intergenic
1178024808 21:28454046-28454068 ATGAGCCTATGGATCTCTGAAGG - Intergenic
1178802646 21:35810539-35810561 AAGATGGTATTGTTCTGTGGCGG - Intronic
1179328590 21:40375894-40375916 AAGAATATATTCATCTCTGGAGG - Intronic
1179790015 21:43750677-43750699 TATATCCTGCTGATCTCTGGAGG - Intronic
1182807692 22:33089104-33089126 CAGATCCGATTAATCACTGGAGG + Intergenic
1184919438 22:47595313-47595335 GAGGTGCTATTGGTCTCTGGTGG + Intergenic
1184969541 22:48005688-48005710 AAGATCATATTGATCTTGGGTGG - Intergenic
949889523 3:8723450-8723472 AAGTTCCTTTTGGTCTCTGGAGG + Intronic
953209904 3:40866609-40866631 AAGTTCATACTCATCTCTGGTGG - Intergenic
953938959 3:47073477-47073499 AAGATACTATACATGTCTGGAGG + Intronic
956315297 3:67928457-67928479 AAGCTCCCAGTGATCTATGGGGG + Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961742844 3:129044957-129044979 AATATCCTTTTGATGTCTGTGGG - Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962189655 3:133297032-133297054 CAGATCCTCTTGGTCTCTGAAGG + Intronic
963976005 3:151481106-151481128 CAGAGCCTCTGGATCTCTGGGGG - Intergenic
964850147 3:161087380-161087402 ATGATCCTATTTGTGTCTGGAGG - Intronic
965701829 3:171465850-171465872 AAGTTGCTATTGATATCTAGTGG - Intergenic
965835626 3:172848778-172848800 AAGAACCTATTGCTCTTTTGTGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970166375 4:13242562-13242584 AAGATCATTTTGATAACTGGTGG - Intergenic
972462031 4:39313507-39313529 AAGATCCTACTTAGCTCTTGCGG - Intronic
986684857 5:10267686-10267708 AAGATCCTTTTGAGCCCAGGAGG + Intergenic
988156638 5:27460862-27460884 AAAATCTTATTGTTCTCTTGTGG - Intergenic
988410040 5:30875331-30875353 AAGTTAATTTTGATCTCTGGGGG + Intergenic
990446695 5:55899760-55899782 AGGATCTTATTCATCCCTGGAGG + Intronic
993861496 5:93142218-93142240 AATATCCTGTTGATATCAGGGGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
996869874 5:128178651-128178673 AGAATACTATTGATGTCTGGTGG + Exonic
997417030 5:133736904-133736926 AAGATCCCCTTGTTCTCTGTGGG - Intergenic
998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG + Intergenic
998994037 5:147851152-147851174 AAGATCCTTTTGATGACTTGAGG - Intergenic
999626365 5:153524840-153524862 AAGATCCTACAGGTCTCTGTAGG + Intronic
1000493719 5:161950501-161950523 AATAACCTATTGATGTCTGGAGG + Intergenic
1001369247 5:171180233-171180255 AAGAAGCAAATGATCTCTGGAGG + Intronic
1003393442 6:5732778-5732800 AAGGTCCTACCTATCTCTGGTGG - Intronic
1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG + Intronic
1010409804 6:75548078-75548100 AAGATCCTGTGTCTCTCTGGAGG - Intergenic
1015060098 6:128953048-128953070 AAGTCCCTATTAATCTCTGTTGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020630690 7:10636230-10636252 AGGATCCTGGAGATCTCTGGTGG + Intergenic
1020824338 7:13008642-13008664 AAGATGCCATTGATCTCAGATGG - Intergenic
1021553110 7:21892863-21892885 AAGATACTGATTATCTCTGGGGG - Intronic
1022252294 7:28620501-28620523 AAGATCATCGTTATCTCTGGAGG + Intronic
1024587754 7:50856245-50856267 GAGATCCTGTAGATCTGTGGAGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030621542 7:111796033-111796055 AAGGTCCTCATGATCTCTGCTGG + Intronic
1031257192 7:119468632-119468654 AAGATCCTATTTCTATCTGCAGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041605718 8:59780536-59780558 GAGATCCAAAAGATCTCTGGAGG - Intergenic
1042220043 8:66464381-66464403 ATGATCCTGTTTATCTTTGGTGG - Intronic
1047269109 8:123337989-123338011 AAGTTACTAATGATTTCTGGAGG - Intronic
1047836033 8:128693276-128693298 TAAATCCTATTGATTGCTGGTGG + Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1050641856 9:7676927-7676949 ATGATCCTGTTGTTCTCCGGAGG + Intergenic
1052275742 9:26674456-26674478 AAGATCATATTGCTCACAGGAGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057257873 9:93565930-93565952 AAGATCCTACTTAGCTCTTGCGG - Exonic
1058870531 9:109198030-109198052 ACAGTCCTAATGATCTCTGGGGG - Intronic
1060760454 9:126243233-126243255 GAAATCCTATTGATTTCTGTAGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186984548 X:14997679-14997701 AAGATGCCATTAATTTCTGGTGG - Intergenic
1187780728 X:22819891-22819913 AACAAACTATTGATCTATGGAGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic
1197601411 X:128535201-128535223 AATATCTTATTTATTTCTGGCGG + Intergenic
1197798736 X:130327212-130327234 ATTATCCTTTTGATGTCTGGAGG + Intergenic
1197882727 X:131185373-131185395 AACATCATAATCATCTCTGGTGG + Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic