ID: 1105916619

View in Genome Browser
Species Human (GRCh38)
Location 13:24922865-24922887
Sequence TTCCCACAGGACCTCGGGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105916619_1105916627 15 Left 1105916619 13:24922865-24922887 CCCGTCCCGAGGTCCTGTGGGAA 0: 1
1: 0
2: 1
3: 13
4: 116
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105916619 Original CRISPR TTCCCACAGGACCTCGGGAC GGG (reversed) Exonic
901041685 1:6368114-6368136 TCCCCTCTGGTCCTCGGGACTGG + Intronic
902581003 1:17407543-17407565 CTCCCACAGGGCCTTGGGACTGG + Exonic
912492587 1:110070380-110070402 TACCTGCAGGACCTCGGGCCCGG - Exonic
912956257 1:114155695-114155717 TTCCCCCAGGAACTCGCGAGGGG - Intergenic
916149185 1:161769509-161769531 TTTCCACAGGAGGTGGGGACAGG + Intronic
916851259 1:168706546-168706568 TTCCCACAAGAGCTGGGGATTGG + Intronic
917329728 1:173868611-173868633 CTCCCTCAGGACCCCGGGAAGGG + Intronic
917626780 1:176854305-176854327 TTCCCACAGAACCTGGGGCCAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924513801 1:244749885-244749907 GTCCCAGAGGACCCCGGGTCTGG + Intergenic
1072015510 10:91342525-91342547 ATACCACAGGACCTGGGCACCGG - Intergenic
1072063650 10:91842934-91842956 TTCCCAAAGCACATGGGGACTGG - Intronic
1072488171 10:95875887-95875909 TTCCCACAGGACCCAGGGGGAGG - Exonic
1074020137 10:109574155-109574177 TGCTCACATGGCCTCGGGACTGG + Intergenic
1076753876 10:132557972-132557994 TTCCCAGTGGACCTGGGGGCTGG + Intronic
1076824044 10:132958329-132958351 TGCCCACAGGACCTGGGGTGTGG + Intergenic
1080516594 11:33027727-33027749 TTCCCACAGGTCCTCTAAACTGG - Exonic
1083005628 11:59343172-59343194 ATCCCACCGTACCTCAGGACAGG + Intergenic
1083393826 11:62374691-62374713 TTCCCACAGGGCCTTGGGACTGG - Intronic
1083517914 11:63278162-63278184 TTCCCTCAAGGCCTCGGGTCAGG - Intronic
1083591017 11:63894935-63894957 CACCCACAGGACCTGGGCACTGG + Intronic
1084353230 11:68618582-68618604 TCCCAACAGGACCCCGTGACTGG - Intergenic
1084360097 11:68663770-68663792 TTCCCACAGGACCACGGCAGGGG + Intergenic
1084464914 11:69317021-69317043 TTCCAACAGGCCCTGGGAACTGG + Intronic
1084651254 11:70490714-70490736 TTCCCACAGGACATCCAGCCTGG - Intronic
1087306854 11:96499316-96499338 TTCCCTCAGGACCTGGAGGCGGG - Intronic
1089209384 11:116790182-116790204 TTCCCACAGGTCATCCAGACGGG + Exonic
1090338544 11:125993638-125993660 TTGCCTCAGGACCTTGGCACAGG - Intronic
1101659184 12:106750772-106750794 TTACCACAGGAGCTCTGCACAGG + Exonic
1102171753 12:110847774-110847796 TTCCCTAGGGACCTTGGGACAGG - Intronic
1105836620 13:24217764-24217786 TGCCCACAGGACCTCGGACCTGG + Intronic
1105916619 13:24922865-24922887 TTCCCACAGGACCTCGGGACGGG - Exonic
1106488274 13:30191824-30191846 TTCCCACAGGAATTTGGGGCTGG + Intergenic
1121691965 14:95884376-95884398 GAGCCACAGGACCTGGGGACTGG + Intergenic
1123717750 15:23042979-23043001 GTCCCCCAGGACCTCTGGCCAGG - Intergenic
1128329189 15:66744846-66744868 GTCCCATAGGAGCTGGGGACAGG - Intronic
1128653264 15:69436236-69436258 TTCCAACTGGACCTCGAGGCTGG - Exonic
1129206824 15:74042189-74042211 TCCCACCAGGACCTTGGGACAGG + Intronic
1132156050 15:99495847-99495869 TTTCCACAGGATCTCTGCACAGG - Intergenic
1132581773 16:688080-688102 CTCCCACAGGGCCACGGGAGTGG - Intronic
1132763579 16:1523439-1523461 TTCCCACAGCCTCTGGGGACAGG + Intronic
1132827689 16:1913346-1913368 TTCCCCCGGGACCTTGGGACTGG - Intronic
1133403951 16:5508505-5508527 CTCCCACCCGACCTCGGGAGTGG - Intergenic
1135635134 16:24069266-24069288 TTGCCCCAGGACATGGGGACTGG - Intronic
1143401880 17:6651617-6651639 ATCCCACAGTGCCCCGGGACCGG - Exonic
1148745551 17:49916093-49916115 TTTCCAGGGGACCTCGGGATGGG - Intergenic
1149491706 17:57089820-57089842 TTCAGAAAGGACCTGGGGACAGG + Intronic
1151507354 17:74538467-74538489 TGCCCACAGTACCTTGGCACTGG - Intergenic
1154497528 18:14973351-14973373 GTCCCACAGGACCTGGGAACTGG + Intergenic
1160398058 18:78586383-78586405 TGCTCACAGGACCTCAGGCCAGG + Intergenic
1160817965 19:1044916-1044938 CTCCCCCTGGACCTCGGGGCTGG - Intronic
1161186832 19:2926832-2926854 TTCCCACAAGCCCCCGGGGCAGG - Intergenic
1161697223 19:5776120-5776142 TGCCCACTGGCCCTAGGGACTGG - Intronic
1163063955 19:14779514-14779536 CCCCCACAGGAGCCCGGGACAGG - Intergenic
1163685470 19:18709629-18709651 TTCCCAGAGGACCTCAGCAGGGG - Intronic
1167088989 19:47330401-47330423 TTCCCACAGGAGATTGGGGCTGG + Intergenic
1167414561 19:49363236-49363258 TTCCCTGAGGACCTCAGGTCCGG - Intronic
927154515 2:20213731-20213753 TAGCCACCGGACCTGGGGACCGG + Intronic
927506328 2:23617276-23617298 TTCCCCCAGGACGGGGGGACAGG - Intronic
930235913 2:48888900-48888922 TTCCCACAGAGCATCAGGACTGG - Intergenic
932759390 2:74429622-74429644 TTCCCACTGGTCTTCTGGACTGG + Intronic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
934236579 2:90238191-90238213 ATCCCACAGCACCTGGAGACGGG + Intergenic
945900181 2:215528699-215528721 TTGCCACAGGACTTCTGGAATGG - Intergenic
948079104 2:235191026-235191048 TTCACACCTGACCTCGTGACAGG - Intergenic
948453679 2:238094023-238094045 TCCCCACAGGTCCTGGGGTCTGG - Intronic
948548497 2:238750218-238750240 TACTCACAGGAGCTTGGGACTGG + Intergenic
1171372312 20:24669754-24669776 TTCCCACAGGAGTGAGGGACGGG + Intergenic
1172709716 20:36912160-36912182 ATCACTCAGGACCTCGGCACAGG - Intronic
1173018228 20:39245876-39245898 TTCCCACAGGATGTGGGGAGTGG + Intergenic
1174195458 20:48769638-48769660 TTGCCACAGGACCTTTGCACTGG + Intronic
1174511967 20:51060206-51060228 CACCCACAGGACCTAGGGATGGG + Intergenic
1176045344 20:63089733-63089755 TGCCCTCAGGACCGCGGGCCAGG + Intergenic
1178975052 21:37214087-37214109 TTCCAACAGGGTCTCGGGCCGGG + Intergenic
1179655321 21:42841360-42841382 TCCCCCCAGGACCTTGGGAATGG - Intergenic
1180675521 22:17583541-17583563 TTCCCATAGGAGGTGGGGACAGG - Intronic
1180982594 22:19885859-19885881 TTCCTTCGGGACCTGGGGACAGG - Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181557718 22:23681433-23681455 CTCCCACAGGGCCTAAGGACAGG - Intergenic
1182430929 22:30298615-30298637 TTCTCGCAGGCCCTTGGGACTGG - Intronic
1183428416 22:37751668-37751690 GTCCCACAGGACTTGGGGACAGG + Intronic
1184656803 22:45946033-45946055 GTCCCCCAGGACCACGGGCCTGG - Intronic
1184895238 22:47402871-47402893 TCCCCACAGGGCCTCGGGGGAGG + Intergenic
951447366 3:22798406-22798428 TTCCCTCAGGAACTAGGGGCGGG - Intergenic
952933217 3:38375720-38375742 TTCCCTCAGGAGCTTTGGACAGG - Intronic
953670667 3:44959334-44959356 TTCCCACAGGACCAGGGTAGGGG + Exonic
955132748 3:56187189-56187211 TTCCCCCAGCACTTCTGGACAGG + Intronic
955311710 3:57894842-57894864 TTCCCACAGGAGCTCTGCTCTGG - Intronic
958564889 3:95797182-95797204 TTCCCACAGGGCCTGAGGTCAGG + Intergenic
961416776 3:126764957-126764979 CTCCCATAGGGCCTTGGGACTGG + Intronic
971503958 4:27346381-27346403 TTCCCACGCGAACTCGTGACAGG - Intergenic
973706881 4:53589737-53589759 TTACCACAGGAACTCTGGACAGG + Intronic
980640176 4:135566731-135566753 TGCCCACAGGACATGGGCACTGG + Intergenic
982694065 4:158579966-158579988 TTCCCACAGGTTCTAGAGACAGG + Intronic
989110748 5:37904718-37904740 TTCCAACAGAACCTTGGGACAGG + Intergenic
990501332 5:56399389-56399411 TTCCCTCAAGACTTCTGGACAGG + Intergenic
990532469 5:56687941-56687963 TGCTCACAGGTCCTCGTGACAGG - Intergenic
1000636831 5:163654217-163654239 TTCCCAGAGCACCTCTGGAATGG - Intergenic
1008885741 6:56430396-56430418 CTCCCACAGGGCCTTGGGACTGG + Intergenic
1013485986 6:110596576-110596598 TTTCCACAGAACATAGGGACAGG + Intergenic
1019333599 7:472216-472238 TTCCCACAGAACTTTGGGAAGGG - Intergenic
1024247153 7:47479322-47479344 TTCAGCCAGGGCCTCGGGACAGG + Intronic
1028017721 7:85736261-85736283 CTCCCACAGGAACTCGGCATGGG + Intergenic
1029044122 7:97609418-97609440 TTCCTACATGACCTTGGCACGGG - Intergenic
1029245064 7:99193414-99193436 TTCCCAGAAGACCTTGGCACAGG + Intronic
1030115652 7:106060387-106060409 TTCCAGGAGGACCTCAGGACAGG + Intergenic
1034564775 7:151904390-151904412 TTCCCACAGGGCCCCGGGTCAGG - Intergenic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1036927468 8:12920898-12920920 TTCCCCCAGAGCCTCGGAACAGG - Intergenic
1037326681 8:17698799-17698821 TTCTCACAGGAACCCTGGACAGG - Intronic
1038127741 8:24693191-24693213 TTCCCAGAGGGCTTGGGGACTGG + Intergenic
1038496582 8:28007628-28007650 GTCCCAAATGACCACGGGACTGG - Intergenic
1039788624 8:40856089-40856111 TTCACACAGGCCCACAGGACAGG + Intronic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1043874172 8:85465263-85465285 TTCCCCCAGGACCTGAGCACTGG + Exonic
1044168156 8:89015029-89015051 TTCCCACATGACCCAGGCACTGG + Intergenic
1049875006 8:145011725-145011747 CTCCCACAGGGCCTTGGGACTGG - Intergenic
1054915034 9:70487817-70487839 TTCCCACAGAGCCTGGGGCCTGG + Intergenic
1056788318 9:89608807-89608829 TATCCACATGACCTTGGGACAGG + Intergenic
1057801957 9:98196176-98196198 TTCCCCAAGGACCTAGGGAAGGG - Intergenic
1060213593 9:121725095-121725117 TTCCCAGAGGAGCTCAGGCCTGG + Intronic
1060481224 9:124017837-124017859 TTCCCGCAGCCCCTCGGGCCCGG + Intronic
1062447110 9:136599672-136599694 TTCCCACAGGATCCTGGTACAGG - Intergenic
1062463242 9:136670546-136670568 TGCAGACAGGACCCCGGGACGGG - Intronic
1187912691 X:24125293-24125315 GTCCCACAGGACCTTGCGAAGGG - Intergenic
1190553212 X:51606541-51606563 TTGCCACAGGATCTAGGGAGAGG + Intergenic
1192074758 X:67982278-67982300 CTCCCACAGGACCTCAGCCCAGG + Intergenic
1192341507 X:70267354-70267376 TTCCCACAGGGCCTAGGCTCAGG - Intergenic
1194935088 X:99938997-99939019 CTCCCACAGGGCCTTGGGACTGG + Intergenic
1199606465 X:149583375-149583397 CTCCCTCAGGTTCTCGGGACAGG - Exonic
1199632657 X:149785993-149786015 CTCCCTCAGGTTCTCGGGACAGG + Exonic