ID: 1105916627

View in Genome Browser
Species Human (GRCh38)
Location 13:24922903-24922925
Sequence GCGCGTCTGCGCTAAAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105916621_1105916627 10 Left 1105916621 13:24922870-24922892 CCCGAGGTCCTGTGGGAAGTGAG 0: 1
1: 0
2: 1
3: 25
4: 203
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916612_1105916627 22 Left 1105916612 13:24922858-24922880 CCCCGCCCCCGTCCCGAGGTCCT 0: 1
1: 0
2: 1
3: 20
4: 273
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916616_1105916627 17 Left 1105916616 13:24922863-24922885 CCCCCGTCCCGAGGTCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916619_1105916627 15 Left 1105916619 13:24922865-24922887 CCCGTCCCGAGGTCCTGTGGGAA 0: 1
1: 0
2: 1
3: 13
4: 116
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916624_1105916627 2 Left 1105916624 13:24922878-24922900 CCTGTGGGAAGTGAGGATCTCAC 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916618_1105916627 16 Left 1105916618 13:24922864-24922886 CCCCGTCCCGAGGTCCTGTGGGA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916622_1105916627 9 Left 1105916622 13:24922871-24922893 CCGAGGTCCTGTGGGAAGTGAGG 0: 1
1: 0
2: 4
3: 26
4: 352
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916620_1105916627 14 Left 1105916620 13:24922866-24922888 CCGTCCCGAGGTCCTGTGGGAAG 0: 1
1: 0
2: 3
3: 15
4: 162
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916614_1105916627 20 Left 1105916614 13:24922860-24922882 CCGCCCCCGTCCCGAGGTCCTGT 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1105916613_1105916627 21 Left 1105916613 13:24922859-24922881 CCCGCCCCCGTCCCGAGGTCCTG 0: 1
1: 0
2: 2
3: 28
4: 318
Right 1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105916627 Original CRISPR GCGCGTCTGCGCTAAAGCGC AGG Intergenic