ID: 1105919659

View in Genome Browser
Species Human (GRCh38)
Location 13:24950170-24950192
Sequence GAGCCACCACGCCCAGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3781
Summary {0: 1, 1: 15, 2: 153, 3: 915, 4: 2697}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105919659_1105919661 1 Left 1105919659 13:24950170-24950192 CCACGGACTGGGCGTGGTGGCTC 0: 1
1: 15
2: 153
3: 915
4: 2697
Right 1105919661 13:24950194-24950216 TGCCTTAATACCAGCACTTTGGG 0: 5
1: 111
2: 381
3: 1912
4: 24438
1105919659_1105919660 0 Left 1105919659 13:24950170-24950192 CCACGGACTGGGCGTGGTGGCTC 0: 1
1: 15
2: 153
3: 915
4: 2697
Right 1105919660 13:24950193-24950215 ATGCCTTAATACCAGCACTTTGG 0: 4
1: 111
2: 359
3: 1035
4: 4068
1105919659_1105919665 14 Left 1105919659 13:24950170-24950192 CCACGGACTGGGCGTGGTGGCTC 0: 1
1: 15
2: 153
3: 915
4: 2697
Right 1105919665 13:24950207-24950229 GCACTTTGGGAGACTGAGGCAGG 0: 2081
1: 66354
2: 184018
3: 236183
4: 275876
1105919659_1105919663 10 Left 1105919659 13:24950170-24950192 CCACGGACTGGGCGTGGTGGCTC 0: 1
1: 15
2: 153
3: 915
4: 2697
Right 1105919663 13:24950203-24950225 ACCAGCACTTTGGGAGACTGAGG 0: 35
1: 4109
2: 100275
3: 222084
4: 245965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105919659 Original CRISPR GAGCCACCACGCCCAGTCCG TGG (reversed) Intergenic
Too many off-targets to display for this crispr