ID: 1105920898

View in Genome Browser
Species Human (GRCh38)
Location 13:24962496-24962518
Sequence ACAGGCGGGAGCCACCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6378
Summary {0: 4, 1: 8, 2: 296, 3: 1606, 4: 4464}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920898_1105920906 3 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920906 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1851
1: 120775
2: 266467
3: 220261
4: 244205
1105920898_1105920912 26 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920912 13:24962545-24962567 TGGGCAGATCACCTGGCGTCAGG 0: 2
1: 139
2: 9151
3: 29197
4: 66070
1105920898_1105920908 6 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920908 13:24962525-24962547 AGCACTTCGGGAGGCCGAGGTGG 0: 1410
1: 92511
2: 186343
3: 138236
4: 81632
1105920898_1105920909 7 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920909 13:24962526-24962548 GCACTTCGGGAGGCCGAGGTGGG 0: 598
1: 39993
2: 188867
3: 270649
4: 197220
1105920898_1105920910 19 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920898_1105920901 -7 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920901 13:24962512-24962534 CGCCTGTAATCCCAGCACTTCGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1105920898_1105920902 -6 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920902 13:24962513-24962535 GCCTGTAATCCCAGCACTTCGGG 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877
1105920898_1105920904 -3 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920904 13:24962516-24962538 TGTAATCCCAGCACTTCGGGAGG 0: 5020
1: 297851
2: 269720
3: 207813
4: 298339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920898 Original CRISPR ACAGGCGGGAGCCACCATGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr