ID: 1105920899

View in Genome Browser
Species Human (GRCh38)
Location 13:24962510-24962532
Sequence GAAGTGCTGGGATTACAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11537
Summary {0: 56, 1: 1866, 2: 2819, 3: 3149, 4: 3647}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920899_1105920908 -8 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920908 13:24962525-24962547 AGCACTTCGGGAGGCCGAGGTGG 0: 1410
1: 92511
2: 186343
3: 138236
4: 81632
1105920899_1105920912 12 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920912 13:24962545-24962567 TGGGCAGATCACCTGGCGTCAGG 0: 2
1: 139
2: 9151
3: 29197
4: 66070
1105920899_1105920909 -7 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920909 13:24962526-24962548 GCACTTCGGGAGGCCGAGGTGGG 0: 598
1: 39993
2: 188867
3: 270649
4: 197220
1105920899_1105920910 5 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920899 Original CRISPR GAAGTGCTGGGATTACAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr