ID: 1105920901

View in Genome Browser
Species Human (GRCh38)
Location 13:24962512-24962534
Sequence CGCCTGTAATCCCAGCACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 988408
Summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920898_1105920901 -7 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920901 13:24962512-24962534 CGCCTGTAATCCCAGCACTTCGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920901 Original CRISPR CGCCTGTAATCCCAGCACTT CGG Intergenic
Too many off-targets to display for this crispr