ID: 1105920902

View in Genome Browser
Species Human (GRCh38)
Location 13:24962513-24962535
Sequence GCCTGTAATCCCAGCACTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1090298
Summary {0: 4742, 1: 224904, 2: 276751, 3: 269024, 4: 314877}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920898_1105920902 -6 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920902 13:24962513-24962535 GCCTGTAATCCCAGCACTTCGGG 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920902 Original CRISPR GCCTGTAATCCCAGCACTTC GGG Intergenic
Too many off-targets to display for this crispr