ID: 1105920903

View in Genome Browser
Species Human (GRCh38)
Location 13:24962514-24962536
Sequence TCCCGAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1065944
Summary {0: 4899, 1: 294023, 2: 265853, 3: 205200, 4: 295969}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920903_1105920912 8 Left 1105920903 13:24962514-24962536 CCTGTAATCCCAGCACTTCGGGA 0: 4899
1: 294023
2: 265853
3: 205200
4: 295969
Right 1105920912 13:24962545-24962567 TGGGCAGATCACCTGGCGTCAGG 0: 2
1: 139
2: 9151
3: 29197
4: 66070
1105920903_1105920910 1 Left 1105920903 13:24962514-24962536 CCTGTAATCCCAGCACTTCGGGA 0: 4899
1: 294023
2: 265853
3: 205200
4: 295969
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920903 Original CRISPR TCCCGAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr