ID: 1105920904

View in Genome Browser
Species Human (GRCh38)
Location 13:24962516-24962538
Sequence TGTAATCCCAGCACTTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1078743
Summary {0: 5020, 1: 297851, 2: 269720, 3: 207813, 4: 298339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920898_1105920904 -3 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920904 13:24962516-24962538 TGTAATCCCAGCACTTCGGGAGG 0: 5020
1: 297851
2: 269720
3: 207813
4: 298339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920904 Original CRISPR TGTAATCCCAGCACTTCGGG AGG Intergenic
Too many off-targets to display for this crispr