ID: 1105920905

View in Genome Browser
Species Human (GRCh38)
Location 13:24962522-24962544
Sequence CCTCGGCCTCCCGAAGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 864253
Summary {0: 1966, 1: 127622, 2: 277472, 3: 217223, 4: 239970}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920905_1105920912 0 Left 1105920905 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1966
1: 127622
2: 277472
3: 217223
4: 239970
Right 1105920912 13:24962545-24962567 TGGGCAGATCACCTGGCGTCAGG 0: 2
1: 139
2: 9151
3: 29197
4: 66070
1105920905_1105920910 -7 Left 1105920905 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1966
1: 127622
2: 277472
3: 217223
4: 239970
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920905_1105920915 27 Left 1105920905 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1966
1: 127622
2: 277472
3: 217223
4: 239970
Right 1105920915 13:24962572-24962594 TGAGACCAGCCTTGCCAACAGGG 0: 296
1: 35936
2: 107540
3: 174518
4: 185662
1105920905_1105920914 26 Left 1105920905 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1966
1: 127622
2: 277472
3: 217223
4: 239970
Right 1105920914 13:24962571-24962593 TTGAGACCAGCCTTGCCAACAGG 0: 2
1: 499
2: 1658
3: 2764
4: 3626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920905 Original CRISPR CCTCGGCCTCCCGAAGTGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr