ID: 1105920906

View in Genome Browser
Species Human (GRCh38)
Location 13:24962522-24962544
Sequence CCCAGCACTTCGGGAGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 853559
Summary {0: 1851, 1: 120775, 2: 266467, 3: 220261, 4: 244205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920898_1105920906 3 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920906 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1851
1: 120775
2: 266467
3: 220261
4: 244205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920906 Original CRISPR CCCAGCACTTCGGGAGGCCG AGG Intergenic
Too many off-targets to display for this crispr