ID: 1105920908

View in Genome Browser
Species Human (GRCh38)
Location 13:24962525-24962547
Sequence AGCACTTCGGGAGGCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 500132
Summary {0: 1410, 1: 92511, 2: 186343, 3: 138236, 4: 81632}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920900_1105920908 -9 Left 1105920900 13:24962511-24962533 CCGCCTGTAATCCCAGCACTTCG 0: 37
1: 1638
2: 1906
3: 1904
4: 3774
Right 1105920908 13:24962525-24962547 AGCACTTCGGGAGGCCGAGGTGG 0: 1410
1: 92511
2: 186343
3: 138236
4: 81632
1105920899_1105920908 -8 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920908 13:24962525-24962547 AGCACTTCGGGAGGCCGAGGTGG 0: 1410
1: 92511
2: 186343
3: 138236
4: 81632
1105920898_1105920908 6 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920908 13:24962525-24962547 AGCACTTCGGGAGGCCGAGGTGG 0: 1410
1: 92511
2: 186343
3: 138236
4: 81632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920908 Original CRISPR AGCACTTCGGGAGGCCGAGG TGG Intergenic
Too many off-targets to display for this crispr