ID: 1105920909

View in Genome Browser
Species Human (GRCh38)
Location 13:24962526-24962548
Sequence GCACTTCGGGAGGCCGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 697327
Summary {0: 598, 1: 39993, 2: 188867, 3: 270649, 4: 197220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920899_1105920909 -7 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920909 13:24962526-24962548 GCACTTCGGGAGGCCGAGGTGGG 0: 598
1: 39993
2: 188867
3: 270649
4: 197220
1105920898_1105920909 7 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920909 13:24962526-24962548 GCACTTCGGGAGGCCGAGGTGGG 0: 598
1: 39993
2: 188867
3: 270649
4: 197220
1105920900_1105920909 -8 Left 1105920900 13:24962511-24962533 CCGCCTGTAATCCCAGCACTTCG 0: 37
1: 1638
2: 1906
3: 1904
4: 3774
Right 1105920909 13:24962526-24962548 GCACTTCGGGAGGCCGAGGTGGG 0: 598
1: 39993
2: 188867
3: 270649
4: 197220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920909 Original CRISPR GCACTTCGGGAGGCCGAGGT GGG Intergenic
Too many off-targets to display for this crispr