ID: 1105920910

View in Genome Browser
Species Human (GRCh38)
Location 13:24962538-24962560
Sequence GCCGAGGTGGGCAGATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135272
Summary {0: 81, 1: 3954, 2: 19186, 3: 49295, 4: 62756}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105920903_1105920910 1 Left 1105920903 13:24962514-24962536 CCTGTAATCCCAGCACTTCGGGA 0: 4899
1: 294023
2: 265853
3: 205200
4: 295969
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920900_1105920910 4 Left 1105920900 13:24962511-24962533 CCGCCTGTAATCCCAGCACTTCG 0: 37
1: 1638
2: 1906
3: 1904
4: 3774
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920907_1105920910 -8 Left 1105920907 13:24962523-24962545 CCAGCACTTCGGGAGGCCGAGGT 0: 559
1: 38189
2: 180898
3: 257200
4: 189119
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920905_1105920910 -7 Left 1105920905 13:24962522-24962544 CCCAGCACTTCGGGAGGCCGAGG 0: 1966
1: 127622
2: 277472
3: 217223
4: 239970
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920898_1105920910 19 Left 1105920898 13:24962496-24962518 CCATCATGGTGGCTCCCGCCTGT 0: 4
1: 8
2: 296
3: 1606
4: 4464
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756
1105920899_1105920910 5 Left 1105920899 13:24962510-24962532 CCCGCCTGTAATCCCAGCACTTC 0: 56
1: 1866
2: 2819
3: 3149
4: 3647
Right 1105920910 13:24962538-24962560 GCCGAGGTGGGCAGATCACCTGG 0: 81
1: 3954
2: 19186
3: 49295
4: 62756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105920910 Original CRISPR GCCGAGGTGGGCAGATCACC TGG Intergenic
Too many off-targets to display for this crispr