ID: 1105923181

View in Genome Browser
Species Human (GRCh38)
Location 13:24983860-24983882
Sequence CACCCTCCAGGAACCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 3, 1: 9, 2: 7, 3: 33, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105923181_1105923188 -7 Left 1105923181 13:24983860-24983882 CCCATGGAGGTTCCTGGAGGGTG 0: 3
1: 9
2: 7
3: 33
4: 174
Right 1105923188 13:24983876-24983898 GAGGGTGGCGCACCCAGGGAGGG 0: 4
1: 31
2: 91
3: 192
4: 546
1105923181_1105923187 -8 Left 1105923181 13:24983860-24983882 CCCATGGAGGTTCCTGGAGGGTG 0: 3
1: 9
2: 7
3: 33
4: 174
Right 1105923187 13:24983875-24983897 GGAGGGTGGCGCACCCAGGGAGG 0: 4
1: 23
2: 90
3: 172
4: 521
1105923181_1105923191 8 Left 1105923181 13:24983860-24983882 CCCATGGAGGTTCCTGGAGGGTG 0: 3
1: 9
2: 7
3: 33
4: 174
Right 1105923191 13:24983891-24983913 AGGGAGGGCACTGAAGCTCCCGG 0: 1
1: 1
2: 8
3: 46
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105923181 Original CRISPR CACCCTCCAGGAACCTCCAT GGG (reversed) Intergenic