ID: 1105923391

View in Genome Browser
Species Human (GRCh38)
Location 13:24985192-24985214
Sequence CATTTTTTCTAGATGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105923391_1105923398 18 Left 1105923391 13:24985192-24985214 CCCACAGCCATCTAGAAAAAATG 0: 1
1: 0
2: 4
3: 27
4: 382
Right 1105923398 13:24985233-24985255 TCGCTGCCTCCCTTCATAGGTGG 0: 1
1: 1
2: 1
3: 14
4: 146
1105923391_1105923397 15 Left 1105923391 13:24985192-24985214 CCCACAGCCATCTAGAAAAAATG 0: 1
1: 0
2: 4
3: 27
4: 382
Right 1105923397 13:24985230-24985252 TCATCGCTGCCTCCCTTCATAGG 0: 1
1: 2
2: 0
3: 15
4: 136
1105923391_1105923399 19 Left 1105923391 13:24985192-24985214 CCCACAGCCATCTAGAAAAAATG 0: 1
1: 0
2: 4
3: 27
4: 382
Right 1105923399 13:24985234-24985256 CGCTGCCTCCCTTCATAGGTGGG 0: 1
1: 1
2: 1
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105923391 Original CRISPR CATTTTTTCTAGATGGCTGT GGG (reversed) Intergenic
903869290 1:26421028-26421050 TTTTTTTTCTTGATGGCTGCTGG + Intronic
905493567 1:38364678-38364700 CATTCTTTGTAGATGCTTGTAGG - Intergenic
905545642 1:38797394-38797416 CATTTTTTCTACTGGGTTGTTGG - Intergenic
905555087 1:38876243-38876265 CTTTTTCCCTAGATAGCTGTGGG + Exonic
905849891 1:41265865-41265887 CATTTTGTCTGGTTAGCTGTCGG - Intergenic
908717918 1:67089699-67089721 TATTTTTTCTAGTTGGCTCAGGG + Intergenic
909541834 1:76800379-76800401 CATCTTCTCTAGAAGCCTGTGGG - Intergenic
909750078 1:79148447-79148469 CCTTTATTCTAGATGTGTGTTGG - Intergenic
911286631 1:96002407-96002429 AATCCTTTCCAGATGGCTGTAGG + Intergenic
911320359 1:96406703-96406725 CATTTTTTCCACATGTTTGTTGG - Intergenic
911347669 1:96716879-96716901 CAATTTTTCTATTTGACTGTTGG + Intergenic
911638373 1:100261087-100261109 CATTTCTTCTAGATTCCTTTTGG + Intergenic
913182758 1:116338061-116338083 CATTTTATTTTGAGGGCTGTAGG - Intergenic
915657635 1:157374962-157374984 CATTTTTTCTGGGTGGGAGTGGG + Intergenic
915671441 1:157492025-157492047 CATTTTTTCTGGGTGGGAGTGGG - Intergenic
915870936 1:159558869-159558891 CATATTTTCTTGATGACTGTGGG - Intergenic
917607320 1:176645850-176645872 CATTTTTTTCACATGCCTGTTGG + Intronic
917652391 1:177090920-177090942 CTTGTTTTCTAGATGGGTGGGGG + Intronic
919561978 1:199132409-199132431 CTTTTTTTCTGCATGGCTTTTGG - Intergenic
919587341 1:199455188-199455210 CACTTTTCCCAGATGGGTGTGGG - Intergenic
921881836 1:220264028-220264050 CATTTTTTTTTAATGGATGTCGG - Intronic
922357845 1:224793760-224793782 CATTTTGTCTAGTTGGCCTTAGG - Intergenic
923971854 1:239212209-239212231 TATTTTTACTTGATGGCTATGGG - Intergenic
923975936 1:239262767-239262789 CCTGTTTTCTTGCTGGCTGTTGG + Intergenic
924855920 1:247874922-247874944 CCTGTTTTCTTGCTGGCTGTTGG + Intronic
1066195626 10:33096790-33096812 AATTTTTTCAAGAAGGATGTTGG + Intergenic
1066522257 10:36234612-36234634 CATTTTTTTCATATGCCTGTTGG - Intergenic
1066749161 10:38635292-38635314 CATTTTTTCTACCTTTCTGTAGG + Intergenic
1066967498 10:42282499-42282521 CATTTTTTCTACCTTTCTGTAGG - Intergenic
1067571411 10:47374091-47374113 CAGTGTTTCTAGATGGCCTTGGG + Intronic
1067678572 10:48409973-48409995 CATTTTTCTTAGATTGCTGCTGG + Intronic
1067823198 10:49549159-49549181 CATTCTTTGCTGATGGCTGTGGG - Intergenic
1068018238 10:51544914-51544936 CATTTTTTCATGTTGTCTGTTGG - Intronic
1069655717 10:70086751-70086773 CCCTTTTTCTAGATGGGTCTGGG - Intronic
1069912277 10:71766877-71766899 CATTTTTTCTAAATAGCTGAAGG - Intronic
1070147926 10:73788210-73788232 CTTTTACTCTAGATGACTGTAGG - Intronic
1070366385 10:75741282-75741304 CCTGTTTTCTTGCTGGCTGTTGG + Intronic
1070776826 10:79114682-79114704 CTTTTTTTCTGGATGGCTCTGGG + Intronic
1071458822 10:85872366-85872388 CATATTCTCTTGATGGCTGAGGG + Intronic
1073930517 10:108568943-108568965 TATTCATCCTAGATGGCTGTTGG + Intergenic
1074448476 10:113539699-113539721 CCTATTTTCTTGCTGGCTGTTGG + Intergenic
1074820697 10:117175984-117176006 CATATTTTCTAAATGGCTGTTGG + Intergenic
1075989566 10:126823826-126823848 CATTTTTACTTTTTGGCTGTTGG - Intergenic
1076476279 10:130755084-130755106 AATTTTCTCAAGATGGTTGTGGG - Intergenic
1078384704 11:10879164-10879186 TATTATTTCTAGATGACTTTTGG + Intergenic
1078640597 11:13092172-13092194 CATTTAATGTAGTTGGCTGTAGG - Intergenic
1078732423 11:13987325-13987347 CATTTTTTTCATATGTCTGTTGG + Intronic
1078994529 11:16683966-16683988 CATTTTTTTCATATGTCTGTTGG - Intronic
1079554845 11:21746532-21746554 CATTTCTTCCAGCTGTCTGTGGG - Intergenic
1080161119 11:29177640-29177662 AATCTTTTATAGATGGGTGTGGG - Intergenic
1082956838 11:58878985-58879007 CACTCTTTGTTGATGGCTGTGGG + Intronic
1082966479 11:58971284-58971306 CATTCTTTGTTGATGGCTGTGGG + Intronic
1084162609 11:67358082-67358104 CATTTTCACAAGATGCCTGTGGG + Intronic
1088358018 11:108963306-108963328 CATTTTTTTTATATGTTTGTTGG - Intergenic
1088547736 11:110977639-110977661 CATTTTTTTTACATACCTGTTGG - Intergenic
1088594881 11:111433782-111433804 CATTTTTTTCATATGCCTGTTGG - Intronic
1090643369 11:128747759-128747781 GGCTTTTTCTAGATGGCAGTGGG - Intronic
1094337272 12:29374100-29374122 CATTCTTTTAAGTTGGCTGTAGG - Intronic
1095111504 12:38299299-38299321 CCTTTTCTCTAGATGCCTTTAGG + Intergenic
1095302016 12:40596063-40596085 CATTTTTTCCATATACCTGTTGG - Intergenic
1095393259 12:41734055-41734077 CATTTTTTCAATGTGTCTGTTGG + Intergenic
1095650855 12:44607242-44607264 CATTTTGCAAAGATGGCTGTAGG - Exonic
1095798961 12:46251716-46251738 CATTTTTTCCATGTGTCTGTTGG - Intronic
1097003593 12:55899273-55899295 CTTTTTCTCTAGCTAGCTGTGGG - Intergenic
1097326362 12:58281728-58281750 CATTTTTTTCATATGCCTGTTGG + Intergenic
1098546537 12:71717848-71717870 CATTCTTTTTAGAGGGCTCTTGG + Intergenic
1098955111 12:76681484-76681506 CCTTTTTTCCATATGGCCGTTGG - Intergenic
1099088170 12:78273100-78273122 CATTTTTTTTATATGATTGTTGG + Intergenic
1099462932 12:82946649-82946671 CTCTATTGCTAGATGGCTGTTGG - Intronic
1101282242 12:103270304-103270326 CATTTCTACTAGATGGAAGTAGG + Intronic
1102833053 12:116025109-116025131 CATTTTTTCTATATACCTGTTGG - Intronic
1104467039 12:128999104-128999126 CATGCTTGCAAGATGGCTGTTGG - Intergenic
1105353916 13:19640490-19640512 CATTTTTTCTGGAAGGCATTTGG + Intronic
1105923391 13:24985192-24985214 CATTTTTTCTAGATGGCTGTGGG - Intergenic
1108132337 13:47316152-47316174 CATTTTTTATATATGTTTGTAGG - Intergenic
1108188549 13:47913326-47913348 CATTTTTTTCATATGCCTGTTGG - Intergenic
1108505930 13:51112073-51112095 TGTTTTTTCAAGAGGGCTGTAGG + Intergenic
1108865977 13:54923111-54923133 CATTTTTTCAATGTGTCTGTTGG - Intergenic
1108929497 13:55798915-55798937 CATTTTTTTCAGATGCTTGTTGG + Intergenic
1109084819 13:57956599-57956621 AATTTTTTTTATATAGCTGTTGG + Intergenic
1109200532 13:59425955-59425977 CATTTATCCTCGATGGATGTTGG - Intergenic
1109519832 13:63495168-63495190 CATTTTTTTTAAATGGATGGTGG + Intergenic
1110083608 13:71348000-71348022 CAACTTTTCTAAATGGCTGCAGG + Intergenic
1110585444 13:77185840-77185862 CATTTTTTTTAAATGACTATAGG - Intronic
1111039988 13:82735300-82735322 CATTTTTTTTATATGTTTGTTGG + Intergenic
1111455080 13:88471725-88471747 CATTTTGTCTAAATTTCTGTAGG - Intergenic
1112860415 13:103823876-103823898 CATTTTATGTAGATGGCGGCAGG + Intergenic
1113242179 13:108350178-108350200 CTTTTTTTCTATTTGGCTGAAGG + Intergenic
1114413299 14:22520155-22520177 CATTTTTGCTTAATGGCTTTGGG - Intergenic
1115427000 14:33271555-33271577 CATGTTATCTACAAGGCTGTTGG - Intronic
1117468808 14:56021254-56021276 CATTGTTTCAAGATGGCTGCTGG + Intergenic
1119819288 14:77600882-77600904 CATTTTGTCCACATGCCTGTGGG + Intronic
1120092171 14:80344712-80344734 CCTGTTTTCTTGCTGGCTGTTGG - Intronic
1120181661 14:81349466-81349488 CATTTTTTTCATATGCCTGTTGG - Intronic
1121491495 14:94364338-94364360 GATATTTTCAAGGTGGCTGTAGG + Intergenic
1202828379 14_GL000009v2_random:1366-1388 CTTTTTTTCTATCTGGCTGGCGG + Intergenic
1123571908 15:21620463-21620485 CATTTTTTCCATATACCTGTTGG + Intergenic
1123608523 15:22063057-22063079 CATTTTTTCCATATACCTGTTGG + Intergenic
1124040217 15:26094976-26094998 TACTTTTTCCTGATGGCTGTGGG - Intergenic
1125107857 15:35995072-35995094 CAATTTTTCCAGATGGCTCCAGG + Intergenic
1125207800 15:37174679-37174701 CATTTTTTTCATATGTCTGTTGG - Intergenic
1126306429 15:47263428-47263450 CCTTTTTTCCAGATGATTGTTGG - Intronic
1126804580 15:52333690-52333712 CATTTTTTTTAAAAGTCTGTTGG + Intronic
1127790706 15:62396351-62396373 CTTTTTTTCTAAATGGTTGCTGG - Intronic
1128858354 15:71040961-71040983 CCTGTTTTCTTGTTGGCTGTTGG - Intronic
1129984534 15:79906134-79906156 GTTTTCTTCTAGTTGGCTGTGGG - Intronic
1130387396 15:83423676-83423698 CAGTTTTTCTAGTTGTCTATGGG - Intergenic
1131359559 15:91778326-91778348 CATTTTTTCTGCATGGCTCCTGG - Intergenic
1131849449 15:96523355-96523377 CATTTTTTTCATATGCCTGTTGG - Intergenic
1202980763 15_KI270727v1_random:354853-354875 CATTTTTTCCATATACCTGTTGG + Intergenic
1134655519 16:15945630-15945652 CATTTTTTGTAGATGTGTTTTGG + Intergenic
1136714438 16:32265641-32265663 CAGTTTTTGTGGATGGCTCTGGG + Intergenic
1136733565 16:32441843-32441865 CATTTTTTCTACCTTTCTGTAGG - Intergenic
1136753451 16:32663776-32663798 CAGTTTTTGTGGATGGCTCTGGG - Intergenic
1136814662 16:33206589-33206611 CAGTTTTTGTGGATGGCTCTGGG + Intronic
1136821138 16:33316669-33316691 CAGTTTTTGTGGATGGCTCTGGG + Intergenic
1136827701 16:33373208-33373230 CAGTTTTTGTGGATGGCTCTGGG + Intergenic
1136832767 16:33471979-33472001 CAGTTTTTGTGGATGGCTCTGGG + Intergenic
1137889949 16:52148896-52148918 CATTTTCTCTAAATGGCTGGAGG - Intergenic
1138631954 16:58303331-58303353 CATTTTTTCCATATACCTGTGGG - Intronic
1138913656 16:61435469-61435491 CATTTTTCCTTGATGACTCTGGG - Intergenic
1140963265 16:79938162-79938184 CATTTTCTCTTGATGTCTTTAGG - Intergenic
1141232716 16:82184765-82184787 CATTTTTTCTATATGGGAGATGG + Intergenic
1141866117 16:86751185-86751207 CATTTTTTTTAAATGGTAGTGGG + Intergenic
1202993238 16_KI270728v1_random:29563-29585 CAGTTTTTGTGGATGGCTCTGGG + Intergenic
1203019518 16_KI270728v1_random:387759-387781 CATTTTTTCTACCTTTCTGTAGG + Intergenic
1203037853 16_KI270728v1_random:660917-660939 CATTTTTTCTACCTTTCTGTAGG + Intergenic
1203055612 16_KI270728v1_random:924128-924150 CAGTTTTTGTGGATGGCTCTGGG - Intergenic
1142515748 17:427455-427477 CCTTTTCTCTAGAAGGCTTTGGG - Intergenic
1142943175 17:3400345-3400367 GATGTTTTCTAAATAGCTGTTGG + Intergenic
1143983712 17:10893111-10893133 CATTTATTCCAGTTGGCTTTAGG + Intergenic
1145815482 17:27792496-27792518 CATTTCTTCTGGCTGGCTGCTGG + Intronic
1146861191 17:36300628-36300650 CTGTTTTACTAGATGGATGTTGG - Intronic
1147091522 17:38104732-38104754 CTGTTTTACTAGATGGATGTTGG - Intergenic
1147105690 17:38215773-38215795 CTGTTTTACTAGATGGATGTTGG + Intergenic
1149380892 17:56092817-56092839 CCTTTTTCCTTGTTGGCTGTGGG + Intergenic
1150878213 17:68993709-68993731 CATCTTTTCTAGATGGTGGATGG - Intronic
1151345246 17:73497460-73497482 CTTTTCTTCTAGTTGCCTGTTGG + Intronic
1154381762 18:13858051-13858073 CATTTTTTTCATATGTCTGTTGG + Intergenic
1155134376 18:22973630-22973652 CATTTTTTATAGATGAATGATGG - Intronic
1155800250 18:30092758-30092780 CATTTTTTGTATATGGTTGTGGG + Intergenic
1156213545 18:34974115-34974137 CATTTTTTCCATAAGCCTGTTGG - Intergenic
1156547853 18:37983494-37983516 CATTTGTTCTGTTTGGCTGTCGG + Intergenic
1157974861 18:52315392-52315414 CATTTTTTTCATATGTCTGTTGG + Intergenic
1158684327 18:59599380-59599402 CATTAATTCTAGATGCCTGATGG - Intronic
1159403250 18:67964492-67964514 CATTATTTCTAGATAGGTCTGGG - Intergenic
1159527685 18:69614268-69614290 CATCTTTTCTAGATGACTTGTGG - Intronic
1159991378 18:74912859-74912881 CTTTTTTTCTAAATGATTGTTGG - Intronic
1161530149 19:4783895-4783917 AATTTTTTTTAGATGCTTGTGGG - Intergenic
1162156630 19:8682952-8682974 CATTGTTTCTGGAAGGTTGTGGG - Intergenic
1162509448 19:11108903-11108925 CAGTTTCTCAACATGGCTGTTGG + Intronic
1163940457 19:20487795-20487817 CATTTTTTTCATATGTCTGTTGG - Intergenic
1164425607 19:28138857-28138879 CATTTTTTATGGATGCCTGTAGG - Intergenic
1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG + Intronic
925648803 2:6066848-6066870 CATTTTTTTAAGATCACTGTGGG - Intergenic
925938739 2:8794196-8794218 CCTTCATTCTAGAGGGCTGTGGG - Intronic
926607928 2:14915908-14915930 CATCTTATGTAGATGGCAGTAGG - Intergenic
928618645 2:33066197-33066219 AATTTTTTCTATATGGTTTTTGG + Intronic
929354953 2:41011251-41011273 AATTTTTTTTAGATGGCTGCGGG - Intergenic
930110034 2:47670867-47670889 GATTTTTTCTAGATTACAGTTGG + Intergenic
930340122 2:50102104-50102126 GATTTATTTTTGATGGCTGTAGG - Intronic
930394691 2:50806162-50806184 CATTTTTTCCAGTTTGATGTAGG + Intronic
930747059 2:54895778-54895800 TTTTTTTTCTTGCTGGCTGTTGG + Intronic
932076292 2:68666690-68666712 CATTTTTTTTATATGCTTGTTGG - Intergenic
932598184 2:73107155-73107177 CATTTTTATTACTTGGCTGTGGG + Intronic
933264378 2:80166538-80166560 CATCTCTTCTATTTGGCTGTTGG + Intronic
933578437 2:84097192-84097214 CATTTTTTCAACATGTCTGTTGG - Intergenic
934312154 2:91877425-91877447 CATTTTTTCTACCTTTCTGTAGG + Intergenic
934581807 2:95448002-95448024 CATGAATTCTAGATGGCTGATGG - Intergenic
934597643 2:95628712-95628734 CATGAATTCTAGATGGCTGATGG + Intergenic
934842251 2:97634280-97634302 CATGAATTCTAGATGGCTGATGG - Intergenic
935288180 2:101584566-101584588 CATTTTTTTCATATGCCTGTTGG + Intergenic
935516068 2:104040542-104040564 TATTTTTTTTAAATGGATGTTGG + Intergenic
937685124 2:124687340-124687362 CAATTTATCTAGATGACTGTGGG + Intronic
938807455 2:134819664-134819686 CATTTTTCCTGGATGCCAGTAGG + Intergenic
938997894 2:136700131-136700153 CATTTTTTTCATATGTCTGTTGG - Intergenic
940153090 2:150624513-150624535 TGTTTTTTCAAGATGGCAGTGGG + Intergenic
940486350 2:154300852-154300874 CATTTCTTCTAGAAAGCTCTGGG - Intronic
940563237 2:155328685-155328707 CATTTTTTTCACATGTCTGTTGG - Intergenic
940587513 2:155672081-155672103 CATTTGTTCTATATGAATGTAGG + Intergenic
941087867 2:161139093-161139115 CATTTTTTCTAAATTACTTTAGG + Intronic
943026627 2:182637332-182637354 AACTTTTTCTGGATTGCTGTGGG - Intergenic
943090245 2:183365440-183365462 CATTTTTTCCACATATCTGTTGG + Intergenic
944312763 2:198252714-198252736 CATTTTCTCTACATCACTGTGGG + Intronic
944372997 2:199008470-199008492 CATTTTTTTCATATGTCTGTTGG + Intergenic
944520120 2:200557091-200557113 CACTGTTTGCAGATGGCTGTGGG - Intronic
948044122 2:234929628-234929650 TATGTTTTCAAGATGTCTGTGGG - Intergenic
948150891 2:235743921-235743943 CAGTTTTCCAAGATGGCTGTTGG + Intronic
1169219148 20:3811455-3811477 CATGTTTTCTAGATGGTTGTGGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171341391 20:24431776-24431798 GAGTTTGTCTGGATGGCTGTTGG - Intergenic
1172785052 20:37463178-37463200 CACTTTATCTAGATTACTGTCGG + Intergenic
1173382885 20:42561828-42561850 CATTTGTGCTAGATTTCTGTTGG + Intronic
1173561832 20:44011608-44011630 CAGTTTTACCAGATGGCTGAGGG + Intronic
1175065532 20:56283562-56283584 CATTTTTTAAAGATAACTGTTGG - Intergenic
1175554917 20:59844051-59844073 CATTTTTTCCATATACCTGTTGG - Intronic
1176918521 21:14657000-14657022 CATGTTTTATCCATGGCTGTAGG - Intronic
1176928915 21:14784293-14784315 CATTTTTTCAATGTGTCTGTTGG - Intergenic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1179398761 21:41064857-41064879 CGTTGTGTCTAGAGGGCTGTGGG + Intergenic
1180538914 22:16423240-16423262 CATTTTTTCTACCTTTCTGTAGG + Intergenic
1181033687 22:20160000-20160022 GATTTTTTATAAAAGGCTGTGGG + Intergenic
1181509622 22:23383245-23383267 AATTTTTTATAAAAGGCTGTTGG - Intergenic
1182635250 22:31721249-31721271 CCTTATTTCTTGATTGCTGTAGG - Intronic
1184455359 22:44606961-44606983 AATGTTTGCTGGATGGCTGTAGG - Intergenic
949115398 3:315278-315300 CACCATTGCTAGATGGCTGTGGG - Intronic
949817920 3:8080611-8080633 CATTTTTTAAATATGCCTGTTGG + Intergenic
949907513 3:8870910-8870932 CATTTCTAAAAGATGGCTGTTGG + Intronic
950225396 3:11229340-11229362 CATTTTTGCTGGAGTGCTGTGGG + Intronic
950414250 3:12859493-12859515 AATTTTTTCTTGAGGTCTGTAGG - Intronic
952150609 3:30586001-30586023 CATGTTTGCTAGATGGCTACAGG + Intergenic
953382636 3:42485655-42485677 CATTTTTTCCATATGTTTGTTGG - Intergenic
954056108 3:48027307-48027329 CTAGTTTTCTAGATGGCTTTTGG - Intronic
954088543 3:48266439-48266461 CATTTCTTCTGGATGGATGGGGG - Intronic
954300629 3:49699110-49699132 CATTTTGTGAAGATGGCTGTGGG + Intronic
955354070 3:58215948-58215970 CATTTTGTCTCTATGGCTGGGGG - Intergenic
955686912 3:61558409-61558431 ACTATTTTCTTGATGGCTGTTGG - Intergenic
956516798 3:70058584-70058606 AATTTTGTTTAGATGGATGTTGG + Intergenic
956616040 3:71173782-71173804 CATGTTTTCTTGAATGCTGTTGG - Intronic
957100465 3:75820268-75820290 CATTTTTTCCAGGTACCTGTTGG - Intergenic
957477720 3:80748492-80748514 CATTTTTTCTTCATATCTGTTGG + Intergenic
958673963 3:97242111-97242133 CATTTTTTCTAAAAGGTTGCTGG - Intronic
958715049 3:97770293-97770315 CATTTTTTTCATATGCCTGTTGG + Intronic
958999192 3:100941761-100941783 CAGTTTTCCTACTTGGCTGTTGG - Intronic
959246159 3:103871556-103871578 CATTTTTTTCATATAGCTGTTGG - Intergenic
959339742 3:105113931-105113953 CCTTTTTTTTATATGTCTGTTGG - Intergenic
961713411 3:128843802-128843824 CATTTTTTCTTGAGGCCTGTAGG + Intergenic
962490533 3:135889643-135889665 CATTTTCTCTTCTTGGCTGTTGG - Intergenic
963272213 3:143296795-143296817 CATTTTTTTTATATACCTGTTGG + Intronic
963514226 3:146288659-146288681 CATTTTTTTCATATGTCTGTTGG + Intergenic
963961765 3:151317061-151317083 CATGTTTTCTAGATAGCAATAGG - Intronic
964361437 3:155901592-155901614 GATTTTTTATATATTGCTGTGGG - Intronic
965927075 3:173994850-173994872 CATTTCTTCTAGAACGCTGTTGG - Intronic
966123006 3:176544507-176544529 CCTGTTTTCTTGCTGGCTGTAGG - Intergenic
967689248 3:192454898-192454920 CATCTATTCTGGATGTCTGTGGG + Intronic
969247264 4:5943888-5943910 CTTTGTATCTAGATAGCTGTAGG - Intronic
970712107 4:18875988-18876010 CACTCTTTGCAGATGGCTGTGGG - Intergenic
971483892 4:27140171-27140193 CATTTTTGATAGTTTGCTGTAGG + Intergenic
971617962 4:28817934-28817956 CATTTTTTGTAGACACCTGTTGG - Intergenic
972016280 4:34250068-34250090 CATTTTTTTCATATGTCTGTTGG + Intergenic
973556346 4:52087027-52087049 CATTTTTTTCATATGTCTGTTGG + Intronic
973754419 4:54060301-54060323 CAGTTTTTATCAATGGCTGTCGG - Intronic
974051956 4:56950000-56950022 CATTCTTTGCTGATGGCTGTGGG - Intergenic
974182867 4:58405753-58405775 CATTTTTTTTATGTGTCTGTTGG - Intergenic
976752421 4:88463216-88463238 AAGTAATTCTAGATGGCTGTTGG + Intronic
976872785 4:89815158-89815180 CTTTTTTTCTATTTGGCTATTGG - Intronic
977001965 4:91515970-91515992 CATTTTTTTTACATGCTTGTTGG + Intronic
977007751 4:91592747-91592769 CAGTTTTCCTAGATGGCTATTGG + Intronic
977839057 4:101679388-101679410 CTTTTTTTCTAGAGTGCTTTAGG + Intronic
978728005 4:111993047-111993069 CATCTTTTCTAGATCTCTGCAGG + Intergenic
980435725 4:132770618-132770640 CATTTTTTCAAGGCTGCTGTAGG - Intergenic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
980743617 4:136985701-136985723 CATGTTTTAGAGATGACTGTAGG - Intergenic
981213053 4:142131377-142131399 CATTTTTACTAGGTGAATGTAGG + Intronic
982760131 4:159272279-159272301 CATATTTTCTAAATTGCTATTGG + Intronic
982855938 4:160383120-160383142 CATCTTATATAGATGGCAGTAGG - Intergenic
983528733 4:168787420-168787442 CATTTTTTCTAGAAGGGTGATGG + Intronic
983730621 4:170989350-170989372 AATATTTTGTAGATGTCTGTTGG + Intergenic
984184468 4:176526462-176526484 CATTTTTTTTAGTTGGTTTTAGG - Intergenic
986266159 5:6193175-6193197 CATTTTTTGTAGAAGGGAGTCGG - Intergenic
986810766 5:11356909-11356931 CATTTTTTTTATATACCTGTTGG - Intronic
987007200 5:13722874-13722896 AACTATTTCTAGATGGCTTTGGG + Intronic
989348947 5:40462364-40462386 CATTTTTTCCATATGTTTGTTGG - Intergenic
989430146 5:41344719-41344741 ATTTTTTTCTAAATGGTTGTAGG - Intronic
991515978 5:67435962-67435984 CATTTTTTCTAGTTTGCCTTGGG - Intergenic
991532554 5:67632056-67632078 CATTTTTGGTAGTTGGGTGTTGG - Intergenic
991644859 5:68791602-68791624 AATTTTTTCTGGTTGGCTATTGG + Intergenic
992784986 5:80161459-80161481 CATTTTTTTCAAATGCCTGTTGG + Intronic
992811362 5:80391900-80391922 CATTTTTTTCACATGTCTGTTGG + Intergenic
992974017 5:82093699-82093721 TATTTTTTCTTGTTGGATGTTGG + Intronic
993815634 5:92541790-92541812 CATTTTTTTCATATGTCTGTTGG - Intergenic
995431976 5:112089355-112089377 CATTTTTTTTATGTGTCTGTTGG + Intergenic
995987285 5:118193619-118193641 CTTTTTTTTTTGATGTCTGTTGG + Intergenic
996209211 5:120784468-120784490 CATATTTTGTATATGCCTGTTGG + Intergenic
996577590 5:124993469-124993491 CATTTTTTTCATATGCCTGTTGG + Intergenic
996585043 5:125077968-125077990 CATTTTTTCCATATGCCTGTTGG - Intergenic
997588176 5:135056702-135056724 AATTTTCTCTAAATAGCTGTTGG + Intronic
998474353 5:142408070-142408092 CATTATTTCTAGATGTCGCTGGG + Intergenic
999860472 5:155640195-155640217 CATTTTTTCATGTTGTCTGTTGG + Intergenic
1000657934 5:163904588-163904610 CATATTTTTTAGCTGGCTGGAGG - Intergenic
1003400319 6:5785271-5785293 GTTTTTTTCTAGATGGCTGTGGG - Intergenic
1004472245 6:15939746-15939768 CTCTTTCTCTAGATGACTGTGGG + Intergenic
1006197847 6:32257869-32257891 CATTTTTTTCATATGTCTGTTGG + Intergenic
1006278377 6:33024937-33024959 CATTTTTTTCATATGCCTGTTGG + Intergenic
1006479419 6:34279876-34279898 CATTCTCTCTAGATGGCAGGGGG + Exonic
1008264961 6:49413658-49413680 CATTTTTTTCATATGCCTGTTGG - Intergenic
1008653178 6:53584401-53584423 CATTTCTTGCAGCTGGCTGTCGG + Intronic
1008730492 6:54476246-54476268 AATCTTTTCTAGATGCATGTGGG - Intergenic
1008940871 6:57044295-57044317 CATTTTTTCCATATGTTTGTTGG - Intergenic
1009331544 6:62427750-62427772 GTTTTTTTGTACATGGCTGTTGG - Intergenic
1010389974 6:75325619-75325641 CATTTTTTCCAAATGTTTGTTGG - Intronic
1010467563 6:76186873-76186895 CATTTTTTTCATATGTCTGTTGG + Intergenic
1010633223 6:78225825-78225847 CATTTTTTTCATATGTCTGTTGG + Intergenic
1011215708 6:85003621-85003643 GATGTTTTGTGGATGGCTGTTGG - Intergenic
1012858805 6:104534297-104534319 CATTTTTACTAGCTGAATGTAGG + Intergenic
1013090103 6:106892720-106892742 CATTATTTATAGATGGGAGTGGG - Intergenic
1013390856 6:109684963-109684985 CATTTTTTCCATATGTCTGTTGG - Intronic
1013602771 6:111720401-111720423 TATTTTTTTTAGATGGCTAAAGG - Intronic
1013658306 6:112268644-112268666 CATTTTTAGTAGCTGGCTGGAGG - Intergenic
1013943955 6:115700003-115700025 CATTTTTTGAATATGCCTGTTGG + Intergenic
1014402082 6:121002609-121002631 CATTTTTTTGATATGGCTCTTGG - Intergenic
1017065210 6:150522546-150522568 CAGTATTTCTAGATAGCTGATGG + Intergenic
1018266722 6:162032201-162032223 CATTTATGCAAGATGGCTGATGG - Intronic
1018383166 6:163278899-163278921 CTTTGTTTCTAGATTGCTTTTGG + Intronic
1019986054 7:4656732-4656754 GATTATTTCAAGATGGCTGCAGG - Intergenic
1020600160 7:10265095-10265117 CATTTTTGCTAGATGTGTATGGG + Intergenic
1021645655 7:22787014-22787036 CATTTTTTCCAACTGGCTTTAGG + Intergenic
1021834446 7:24655111-24655133 CATCTTTTCTACATTGCTGGTGG + Intronic
1023070274 7:36424136-36424158 CCTTTTTTCCACATGACTGTAGG + Intronic
1023497412 7:40813199-40813221 CATATTTTGTAGATGTCTTTTGG + Intronic
1024188818 7:46984154-46984176 CATTGATTCTATATGGCTTTGGG + Intergenic
1024545990 7:50519121-50519143 CATTTTTTTTATATGTTTGTTGG - Intronic
1025059312 7:55790989-55791011 CATTGTTTTTAGATGTCTCTGGG - Intergenic
1025141097 7:56465999-56466021 TTTTTTTTCTATGTGGCTGTTGG + Intergenic
1025614916 7:63110012-63110034 CATTGTTTTTAGATGTCTCTGGG - Intergenic
1025955725 7:66181366-66181388 CATATTTTCCAGCTGGGTGTGGG - Intergenic
1026540388 7:71275108-71275130 CCATTTTCCAAGATGGCTGTAGG - Intronic
1028429250 7:90728329-90728351 CATTTTTATTAGTTGGATGTTGG + Intronic
1030242294 7:107341724-107341746 TATTTTTGTCAGATGGCTGTAGG - Intronic
1030364839 7:108633778-108633800 CATTTTTTTCATATGTCTGTTGG + Intergenic
1031129086 7:117810454-117810476 CATGTTTTCTAGAAGGCACTAGG + Intronic
1031829150 7:126605034-126605056 CACTTTTTCTTGATTACTGTAGG - Intronic
1033036801 7:137882921-137882943 CATTTTCCCTAGATGGTTATGGG - Intronic
1034575536 7:151993949-151993971 TATTTTTTCTTTATGGTTGTAGG + Intronic
1034698915 7:153079927-153079949 CATTTTTTTCATATGTCTGTTGG + Intergenic
1035644483 8:1207828-1207850 CATTTTTTCCATATGTTTGTTGG + Intergenic
1036714756 8:11110391-11110413 CATTTCTATTAGATGGCTTTTGG - Intronic
1037214170 8:16428117-16428139 CTTGTTTTCTGGATGGCTGTTGG - Intronic
1037376030 8:18230008-18230030 CATTTTTTTTACATACCTGTAGG - Intergenic
1037745252 8:21638512-21638534 CATTTTTTTCATATGCCTGTTGG - Intergenic
1038518558 8:28208520-28208542 CATTTTTTCTTAATGGTTATTGG + Intergenic
1038609442 8:29046570-29046592 CATGTTTTCTTGAAGGCTGAAGG - Intronic
1041168334 8:55114336-55114358 CATTTTTTTCATATGTCTGTTGG + Intronic
1041387721 8:57321710-57321732 CATTTTTTCCATGTGCCTGTTGG + Intergenic
1042057479 8:64781373-64781395 CATTTTTTTTACATTTCTGTGGG + Intronic
1042227740 8:66527601-66527623 TATTTTTTTTAGCTGGTTGTTGG + Intergenic
1042416649 8:68527877-68527899 TATTTTTTCTTAATGGTTGTAGG + Intronic
1042527554 8:69780030-69780052 CATTTTTTTCATATGCCTGTAGG - Intronic
1043362735 8:79494317-79494339 CATTTTTTTCATATGCCTGTTGG + Intergenic
1044399074 8:91749149-91749171 CATTTTTTCATTCTGGCTGTTGG - Intergenic
1044765475 8:95568258-95568280 CATTTTTTCCATATACCTGTTGG - Intergenic
1045132519 8:99171599-99171621 TATTATTTCTAGATGTCTGTAGG - Intronic
1046142082 8:110107107-110107129 GATTTTTTTTATATGACTGTTGG - Intergenic
1046372004 8:113322396-113322418 CTTTTTTTATAAATGGCTCTGGG - Intronic
1046895605 8:119468876-119468898 CTTTTTTTCTATATGATTGTTGG - Intergenic
1048942794 8:139416743-139416765 CATGGTTTCAAGATGGCTGCTGG - Intergenic
1050375121 9:4963393-4963415 CATTGTTTGTGGATGGATGTCGG + Intergenic
1050481560 9:6092981-6093003 CATTTTTTTTATATGTTTGTTGG + Intergenic
1050832779 9:10035210-10035232 CTTTTTTTCAATATGGTTGTTGG + Intronic
1050881336 9:10703779-10703801 CATTTTTTCCATATGTTTGTTGG + Intergenic
1051244657 9:15097721-15097743 CTTTTTTGCAAGAAGGCTGTGGG + Intergenic
1051777211 9:20648617-20648639 TATATTTTCTAGATGTCTATTGG - Intergenic
1052106146 9:24519106-24519128 CAGTTTTTCTAAATGGCCCTAGG - Intergenic
1052841767 9:33297665-33297687 CCTGTTTTCTTGCTGGCTGTTGG + Intronic
1052946931 9:34176143-34176165 CCTTTTTTCTCTATTGCTGTTGG + Intergenic
1053076282 9:35137504-35137526 CACTTTTTGCTGATGGCTGTAGG - Intergenic
1054830469 9:69619459-69619481 CATTTGTTCTTTATGGCTGAGGG - Intronic
1054880385 9:70138661-70138683 CATTTTTTTTATATACCTGTTGG + Intronic
1055879477 9:80982746-80982768 CATTTTTTAAAGATTGCTTTTGG + Intergenic
1056127932 9:83555032-83555054 CATTTCTTATAGGTGGCTTTGGG - Intergenic
1056728315 9:89142064-89142086 CATTCTTTGCTGATGGCTGTGGG - Intronic
1057968848 9:99533501-99533523 CATTTTTTCTAAATATCTGCTGG + Intergenic
1058098485 9:100890736-100890758 CTTTTTTTCCATATGTCTGTTGG + Intergenic
1058144354 9:101395154-101395176 CATTTTTTTTATATACCTGTTGG - Intronic
1059641571 9:116221848-116221870 CATTTCTTCTACATAGCTGTTGG - Intronic
1061315266 9:129791749-129791771 CATTTTCTCTAGATGTCATTAGG - Intergenic
1061924160 9:133797881-133797903 CATTTTTCCCAGCAGGCTGTAGG + Intronic
1185864061 X:3606887-3606909 CATTTGTTCTGTATGGCTGGAGG + Exonic
1186134995 X:6510140-6510162 ACTTTTTTCTAGATGCTTGTTGG - Intergenic
1186210114 X:7241930-7241952 CATTTTTTTTTGCTGGCTGTTGG + Intronic
1186729277 X:12391339-12391361 CATTTTTCACAGATGTCTGTAGG - Intronic
1187316308 X:18198433-18198455 CATTTTTTCATGTTGTCTGTTGG - Intronic
1188192941 X:27194708-27194730 CATTTTTTCCATATACCTGTTGG + Intergenic
1188357057 X:29204480-29204502 CATTTTTTCCATATACCTGTTGG + Intronic
1189167526 X:38875630-38875652 CATTTTTTTCACATGTCTGTTGG + Intergenic
1189219012 X:39355005-39355027 CATCGTTACAAGATGGCTGTGGG + Intergenic
1189686862 X:43573508-43573530 CATTTTGTCCATGTGGCTGTTGG - Intergenic
1190027770 X:46941665-46941687 CATTTTTTTCATATGTCTGTTGG + Intronic
1192868581 X:75163142-75163164 CTTGTTTTCTTGCTGGCTGTTGG + Intergenic
1193056080 X:77152673-77152695 CATTTTTTTCATATGTCTGTTGG - Intergenic
1193430777 X:81401451-81401473 CATATTTTCCATATGCCTGTTGG + Intergenic
1194124251 X:89993904-89993926 GATTTTTTCTAAATGGTTGAAGG + Intergenic
1194454800 X:94089681-94089703 CATTTTTTCTAGATATATGTAGG + Intergenic
1195397589 X:104427961-104427983 CATTTTTTCTAGATTCCTGTGGG - Intergenic
1195474147 X:105264837-105264859 CATTGTCTCTAGAGGGATGTTGG + Intronic
1195534708 X:105998152-105998174 CATTTTTTCACAATGCCTGTTGG - Intergenic
1195622524 X:106971697-106971719 CATTTTTTTCATATGTCTGTTGG - Intronic
1195838677 X:109148650-109148672 CATTTTTTCCATATGCTTGTTGG - Intergenic
1196177814 X:112659613-112659635 AATTTTTCCTAGTTGGTTGTGGG - Intronic
1196951296 X:120877620-120877642 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196952120 X:120933970-120933992 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196952805 X:120938831-120938853 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196953490 X:120943691-120943713 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196954175 X:120948552-120948574 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196954859 X:120953412-120953434 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196955549 X:120958295-120958317 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196956229 X:120963156-120963178 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196956911 X:120968016-120968038 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196957593 X:120972876-120972898 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196958275 X:120977736-120977758 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196958957 X:120982596-120982618 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1197120509 X:122885506-122885528 CATTTTTTCCATATGCTTGTTGG - Intergenic
1198086126 X:133284337-133284359 CATTTTTTTCATATGTCTGTTGG - Intergenic
1198285847 X:135191071-135191093 CATTTTTTTAATATGCCTGTTGG - Intergenic
1198498165 X:137214841-137214863 CATTCTTTGCTGATGGCTGTGGG + Intergenic
1199115553 X:143987751-143987773 TATTTTTTCTATATAGCTGGTGG + Intergenic
1199122310 X:144070008-144070030 CATTTTTTCCATGTGTCTGTTGG + Intergenic
1199406032 X:147461836-147461858 CATTTTTTTCATAGGGCTGTTGG - Intergenic
1200477143 Y:3651526-3651548 GATTTTTTCTAAATGGTTGAAGG + Intergenic
1200800121 Y:7379128-7379150 CATTTGTTCTGTATGGCTGGAGG - Intergenic
1201180125 Y:11334896-11334918 CATTTTTTCTACCTTTCTGTAGG + Intergenic
1201618248 Y:15925831-15925853 ACTTTTTTCCAGATGACTGTTGG - Intergenic
1202371196 Y:24197187-24197209 CTCTGTTTCTAGATGGCTATTGG - Intergenic
1202499588 Y:25472930-25472952 CTCTGTTTCTAGATGGCTATTGG + Intergenic