ID: 1105925596 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:25004776-25004798 |
| Sequence | TACCCGTGAATAAACGCGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 15 | |||
| Summary | {0: 2, 1: 0, 2: 0, 3: 3, 4: 10} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105925596_1105925601 | 12 | Left | 1105925596 | 13:25004776-25004798 | CCTCCCGCGTTTATTCACGGGTA | 0: 2 1: 0 2: 0 3: 3 4: 10 |
||
| Right | 1105925601 | 13:25004811-25004833 | TCACGTCCTCGAGCTCCTCTTGG | 0: 2 1: 0 2: 0 3: 13 4: 100 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105925596 | Original CRISPR | TACCCGTGAATAAACGCGGG AGG (reversed) | Intergenic | ||