ID: 1105925597 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:25004779-25004801 |
| Sequence | TGCTACCCGTGAATAAACGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 23 | |||
| Summary | {0: 2, 1: 0, 2: 0, 3: 1, 4: 20} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105925597_1105925601 | 9 | Left | 1105925597 | 13:25004779-25004801 | CCCGCGTTTATTCACGGGTAGCA | 0: 2 1: 0 2: 0 3: 1 4: 20 |
||
| Right | 1105925601 | 13:25004811-25004833 | TCACGTCCTCGAGCTCCTCTTGG | 0: 2 1: 0 2: 0 3: 13 4: 100 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105925597 | Original CRISPR | TGCTACCCGTGAATAAACGC GGG (reversed) | Intergenic | ||