ID: 1105925598

View in Genome Browser
Species Human (GRCh38)
Location 13:25004780-25004802
Sequence CTGCTACCCGTGAATAAACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 21}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105925598_1105925601 8 Left 1105925598 13:25004780-25004802 CCGCGTTTATTCACGGGTAGCAG 0: 2
1: 0
2: 0
3: 1
4: 21
Right 1105925601 13:25004811-25004833 TCACGTCCTCGAGCTCCTCTTGG 0: 2
1: 0
2: 0
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105925598 Original CRISPR CTGCTACCCGTGAATAAACG CGG (reversed) Intergenic