ID: 1105926661

View in Genome Browser
Species Human (GRCh38)
Location 13:25014839-25014861
Sequence AAGGGCCCTGAATATGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105926655_1105926661 14 Left 1105926655 13:25014802-25014824 CCACCTCTCGGTGGGAGGGGCTC 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1105926661 13:25014839-25014861 AAGGGCCCTGAATATGTGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1105926659_1105926661 -8 Left 1105926659 13:25014824-25014846 CCAAAGTCATATTGCAAGGGCCC 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1105926661 13:25014839-25014861 AAGGGCCCTGAATATGTGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 147
1105926656_1105926661 11 Left 1105926656 13:25014805-25014827 CCTCTCGGTGGGAGGGGCTCCAA 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1105926661 13:25014839-25014861 AAGGGCCCTGAATATGTGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105926661 Original CRISPR AAGGGCCCTGAATATGTGCA GGG Intergenic
905172516 1:36117476-36117498 AAAAGCCCTGAATATATTCAGGG + Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
908586917 1:65579718-65579740 AAGCCCCGTGAATATGTGTAAGG + Intronic
910347084 1:86251834-86251856 AAGGGTCTTGATTGTGTGCAGGG - Intergenic
912224123 1:107712593-107712615 AAGGGGACCGAATATGTGCAAGG + Intronic
912232964 1:107817086-107817108 AAGAGCCATGAATATGTCCTTGG - Intronic
913203663 1:116516515-116516537 AAAGACACTGAATATTTGCAAGG - Intronic
915472773 1:156135845-156135867 AAGGGCCCTAAGTATGGGGAAGG - Intronic
916975588 1:170074376-170074398 CAGGGCCCTGAAGATGTTCTTGG - Intronic
917157704 1:172022252-172022274 AAGAGCCCTGATTATGTGCCAGG - Intronic
919502363 1:198353434-198353456 CAGGCCCCTGAATTTCTGCAGGG - Intergenic
921095613 1:211884880-211884902 GAGGCCCCTGAATATGCACAAGG - Intergenic
922178519 1:223215556-223215578 AATGGCTCTGAACATGTGGATGG + Intergenic
922292277 1:224218320-224218342 AGGAGCCCTGAATATGGTCAAGG - Intergenic
923423488 1:233844237-233844259 AAGTGCCCTGAATCTTTTCAGGG - Intergenic
1063301419 10:4852407-4852429 AAGGGCCCTGAACAAATGCTGGG + Intergenic
1069517902 10:69094032-69094054 AAGAGCTCTGACTATGTGCTAGG + Intronic
1070633936 10:78108819-78108841 AAGGGCACTTACTATGTGCCAGG + Intergenic
1071148558 10:82604427-82604449 AATGGCCTTCAATATGTGAATGG - Intronic
1071860691 10:89669677-89669699 AAGGTCCCTAAATAACTGCATGG - Intergenic
1073116206 10:101093368-101093390 AGGGGCCCTGAAGGTGGGCAAGG - Intronic
1074151067 10:110760258-110760280 AAGGGCAATGCACATGTGCATGG - Intronic
1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG + Intergenic
1076798034 10:132808236-132808258 AGGGGCCCTGCACGTGTGCAGGG + Intergenic
1077621993 11:3733888-3733910 TAGGTAGCTGAATATGTGCAAGG - Intronic
1081261851 11:40971287-40971309 CAGGGTCCTGAGGATGTGCAGGG - Intronic
1086609754 11:88741568-88741590 ATGTGCCATGAAAATGTGCAGGG + Intronic
1089388645 11:118085044-118085066 AAAGGTGCTGAAAATGTGCACGG + Intronic
1091678366 12:2508096-2508118 AAGGGCCATGAAGATCTGCAGGG - Intronic
1099735117 12:86557455-86557477 GAGGGCCCAGATAATGTGCATGG - Intronic
1100872593 12:98926041-98926063 CACAGCCCTGTATATGTGCATGG - Intronic
1100946940 12:99795800-99795822 AAAGGCCTTGAATTTGTGGATGG - Intronic
1101797425 12:107988414-107988436 AAGTGCCCAAAATATGTGTATGG + Intergenic
1102384397 12:112495727-112495749 AAGTGTCCTGAATACGTTCAAGG - Intronic
1105755665 13:23461520-23461542 AAGGGACTTGAGTATGTGTATGG - Intergenic
1105926661 13:25014839-25014861 AAGGGCCCTGAATATGTGCAGGG + Intergenic
1106701572 13:32234655-32234677 GAGGGCCCGGAATATCTGGAAGG - Exonic
1106797211 13:33218994-33219016 AAGGGCCCTGGAAATCTACAGGG + Intronic
1107835274 13:44407926-44407948 TAGTGCCCTGGTTATGTGCAGGG - Intergenic
1108271372 13:48763046-48763068 GATGACACTGAATATGTGCATGG - Intergenic
1108517212 13:51214755-51214777 AAGTGCCCTGAAGACATGCAAGG + Intergenic
1109375289 13:61485163-61485185 AAGGGGCCTGTGTATGTGAAAGG - Intergenic
1110368426 13:74714089-74714111 AAGAGCTCTGAAGATGTACAGGG - Intergenic
1112452208 13:99522855-99522877 AAGGGTCCTGTGTATGAGCAAGG - Intronic
1114407623 14:22471605-22471627 AGGGGCCCTGAAGATGCTCATGG - Intergenic
1118071186 14:62248320-62248342 AAAGGCACTGAATCTGTGGAAGG - Intergenic
1120129480 14:80788197-80788219 GAGGGCCCTGGGTATGTCCAGGG - Intronic
1125182586 15:36894777-36894799 AATGGGCATGAATATGGGCATGG - Intronic
1125685706 15:41562028-41562050 AAGGGCCCTGAATGGGAGCTGGG + Intronic
1129145047 15:73639427-73639449 AAGAGCCATGAAGATATGCATGG - Intergenic
1134429832 16:14193101-14193123 AAGGGGCCAGAATGTGTGTAGGG - Intronic
1137253615 16:46757882-46757904 AGGGGCCCTGGGGATGTGCAGGG + Intronic
1144187831 17:12812985-12813007 AAGGCCCTTGCATGTGTGCATGG - Intronic
1145106799 17:20124429-20124451 AAGGGCCCTGAAGAAGTGTTGGG + Intronic
1147190411 17:38735158-38735180 AAGGGCCCAGAAAAAGTGGAAGG + Exonic
1149645488 17:58238272-58238294 AAGGGCAGTGAATATATGAATGG + Intronic
1152528913 17:80905661-80905683 AAGGACCCTGGCAATGTGCAGGG - Intronic
1155517668 18:26639661-26639683 ATGGGCGCTGATTATGTGCCTGG + Intronic
1156171286 18:34489678-34489700 AAGCCCCCTGCATATGAGCAGGG - Intergenic
1165047587 19:33117877-33117899 GATGGCCCTGAATAAGTCCATGG - Exonic
1167600153 19:50450212-50450234 CAGGGCCCTTACTATGTGCCAGG + Intronic
925320178 2:2960093-2960115 AAGAGCCCTCAAGATGTGAAAGG - Intergenic
925519762 2:4730431-4730453 AAAGCCCATGAAAATGTGCATGG - Intergenic
926440966 2:12888373-12888395 AGGGGCCCTGAATCTGTGATTGG + Intergenic
927452867 2:23223892-23223914 CAGGGCCCTGATTCTGGGCATGG + Intergenic
927844860 2:26466116-26466138 AGGGGCACTGAAGATGAGCAGGG - Intronic
931264287 2:60646704-60646726 AGGGCCCCTGAAGATGTGCAGGG - Intergenic
931880845 2:66569063-66569085 AATGGGCATGAATATGGGCATGG + Exonic
932047260 2:68362304-68362326 CAGGCGCCTGAATAGGTGCAGGG - Intergenic
933814744 2:86056905-86056927 AAGAGCTCTGAAGATATGCAAGG + Intronic
937684007 2:124676331-124676353 AAGGGCTATGCACATGTGCAGGG - Intronic
940214180 2:151287766-151287788 AAGTGCTCTGAATGTCTGCAGGG - Intronic
941356915 2:164504857-164504879 AAGGGGCCTTAATAAGTGGAAGG + Intronic
943353627 2:186823836-186823858 AAGGCCCCTGAATCTTTGTAGGG - Intergenic
946755844 2:222946852-222946874 CAGGGCCCAGAATATGGCCATGG - Intergenic
1169904086 20:10582950-10582972 AAAGGCCCTGAATATTTTCATGG + Intronic
1172178746 20:32987841-32987863 ATGGGCCCTGACTATGTGCCGGG + Intronic
1177187406 21:17812919-17812941 GAGGGCCCTGCATTTGGGCAAGG - Intronic
1179646895 21:42781787-42781809 AAGTCCCCTGAATATGTCCCTGG - Intergenic
1180185321 21:46136500-46136522 AGGGGCCCTGGTTCTGTGCATGG - Intronic
1181019759 22:20093473-20093495 CACACCCCTGAATATGTGCAGGG - Intronic
1181810298 22:25400085-25400107 AAGGGCCTTGGAAATGGGCAGGG + Intronic
1182770198 22:32789489-32789511 AAGCGCCCTGAATTGGTGCCTGG - Intronic
949953842 3:9251362-9251384 AAAGGGCCTGAACATGTCCAGGG - Intronic
950967187 3:17154581-17154603 AAGGGCCAGGAAGCTGTGCATGG + Intergenic
959477518 3:106829277-106829299 AAGGTCCCTGAATAGCTTCATGG - Intergenic
961051321 3:123749496-123749518 TAAGGCCCTGAATAACTGCATGG + Intronic
961087104 3:124077444-124077466 AGTGGCCCTGCATATGTGCATGG - Intergenic
963777559 3:149454409-149454431 AAGTGCCCTGAAGAAGTACAAGG - Intergenic
963792469 3:149598068-149598090 AAGGTCCCTGAATATGTGACAGG + Intronic
965334650 3:167421446-167421468 ATGGTCCCTGAATGTTTGCATGG - Intergenic
967947128 3:194812905-194812927 GAGGGCCCTCATTCTGTGCAAGG + Intergenic
969049910 4:4365399-4365421 AAGGGCCCTGAGGAAGGGCAGGG - Intronic
969980926 4:11153503-11153525 AAGGGCTGTGCATATGTGCGTGG + Intergenic
970541184 4:17081507-17081529 AAAGACCCTGCATATGAGCAAGG - Intergenic
971850900 4:31985485-31985507 AAGGGCCATGAAATTCTGCAAGG + Intergenic
972989015 4:44800540-44800562 GAAGGCCATGAACATGTGCAGGG - Intergenic
973297706 4:48543891-48543913 TAGGGCCCTGAAAATCTGAAAGG + Exonic
975320109 4:73000403-73000425 TAGGGCCCTAAATTTCTGCATGG + Intergenic
975557163 4:75676127-75676149 AAGGGGCCTGAACCTGGGCAGGG - Intronic
976997137 4:91448589-91448611 AAGGACCCTGAATTTTTGCATGG - Intronic
979479444 4:121199474-121199496 AAAGGCCCTGGTTATGAGCAGGG + Intronic
980771340 4:137377583-137377605 TAAGGTCCTGAATAAGTGCATGG - Intergenic
981317550 4:143355338-143355360 AAAGGCTCTGGAAATGTGCAAGG - Intronic
986493799 5:8320939-8320961 CAGGGCCCTGAATTTGTTAATGG + Intergenic
987663235 5:20904673-20904695 GAGTGCCCTGAATATGAACATGG - Intergenic
988759456 5:34297512-34297534 GAGTGCCCTGAATATGAACATGG + Intergenic
990346978 5:54880969-54880991 ATGGGCCCTGAATATCAGAAGGG - Intergenic
995019140 5:107347385-107347407 AAGGGCCGTGCATATGTGTTAGG - Intergenic
995455061 5:112342491-112342513 AAGGGCCTTGAAAATGTGCCTGG - Intronic
997000564 5:129754155-129754177 AAGAGCCCTGGTTATCTGCAGGG + Intronic
1003550475 6:7098394-7098416 AGGGGGCCTGAAGATGTGGAAGG - Intergenic
1004391040 6:15209968-15209990 CAGGGCCTAGAATAAGTGCATGG - Intergenic
1005023611 6:21441493-21441515 ACGGGCACTGACTATGTGTAAGG - Intergenic
1005457679 6:26036774-26036796 AAGAGCCTTGGATATGTACAGGG + Intergenic
1006584253 6:35095930-35095952 CAGGTCCCTGAATATGCACATGG + Intergenic
1007931029 6:45690635-45690657 GGTGGCCCTGAATATATGCAGGG + Intergenic
1007958404 6:45937635-45937657 AAGGGCACTGCTTATGTGCCAGG - Intronic
1008135908 6:47776806-47776828 ATGGGCCATGATTGTGTGCAGGG - Intergenic
1009193397 6:60656087-60656109 GAGAACCCTGAGTATGTGCACGG + Intergenic
1011337287 6:86275576-86275598 AAGAGCTCTGATGATGTGCAAGG + Intergenic
1012638740 6:101581851-101581873 ATGGGCCCTGAATGTGTGGTTGG + Intronic
1013534902 6:111055057-111055079 AATGGCCCTGAATAAGTGAGGGG - Intergenic
1014829203 6:126081523-126081545 AAGGCCCCTGAATTTTTGTAGGG - Intergenic
1015725927 6:136299791-136299813 TAGGGCCCTGAATCACTGCATGG - Intergenic
1018094728 6:160375207-160375229 AAGGGTCCTGGTTGTGTGCATGG - Intronic
1020138268 7:5598557-5598579 AAGCGCCCTGCTTATTTGCAAGG + Intronic
1020747797 7:12099671-12099693 AAGGTACCTGAAAATGTGGAAGG + Intergenic
1021471166 7:21003517-21003539 AAGCTCCCAGAAGATGTGCATGG - Intergenic
1023224143 7:37951555-37951577 TAGGGCACTGACTATGTGCCAGG - Exonic
1024256442 7:47543384-47543406 AGGGGCTCAGGATATGTGCATGG + Intronic
1024528420 7:50370391-50370413 AAGAGGCCTGAATCTGTGCCAGG - Intronic
1024755397 7:52524313-52524335 AAAGGCCATGAATATGTGGGCGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029614182 7:101645928-101645950 AAGCACCTTGAATATGTCCAGGG + Intergenic
1030007356 7:105132460-105132482 GTGGTCCCTGAAAATGTGCAGGG - Intronic
1030986709 7:116250256-116250278 AAGGGTCCTGGTCATGTGCAGGG - Exonic
1031958924 7:127971433-127971455 AAGGGCCTTGTGTCTGTGCAAGG + Intronic
1032016327 7:128382581-128382603 AAGGCAGCTGAATATGTGCAGGG - Intergenic
1032790895 7:135241679-135241701 AAGGGCTGTGAAAATGTACAAGG - Intronic
1034051555 7:147989445-147989467 GAGAGCTCTGACTATGTGCAAGG - Intronic
1034695834 7:153052615-153052637 AATGGCCCTGGATATTTTCAGGG - Intergenic
1035193846 7:157198192-157198214 AAGCGGTCTGAATATATGCATGG - Intronic
1035557652 8:578764-578786 AAGGACCCTGAGGAAGTGCAGGG - Intergenic
1037634874 8:20692545-20692567 AGTGGCTCTGAATATTTGCAAGG + Intergenic
1038127897 8:24694912-24694934 AAGATCCCTGAATAACTGCATGG - Intergenic
1040861933 8:52008179-52008201 AAGGGCCCTGGGGATGCGCATGG + Intergenic
1043478056 8:80624671-80624693 CATGGCCCTCAATATGTGCCAGG + Intergenic
1044991223 8:97797816-97797838 TAGGCCCCTGAATATGTTCCAGG - Intronic
1046273902 8:111931701-111931723 AAGGTCCCTAAAGATGTGCTGGG + Intergenic
1047608746 8:126500084-126500106 ATGGTCCCTGAAGCTGTGCAGGG - Intergenic
1049490854 8:142901009-142901031 AAGGGCCCTGAATTTCTGTTGGG - Intronic
1050183195 9:2942574-2942596 AAATGCCCTGAATCTGTGCTAGG + Intergenic
1052604148 9:30677246-30677268 AAAGGCCCTAAATATCTGGATGG + Intergenic
1059054861 9:110968809-110968831 ATGTGCCCAGAATATGTGCCAGG + Intronic
1060157907 9:121332757-121332779 AAGGACTCTGAATTTTTGCAGGG - Exonic
1060405164 9:123369336-123369358 CAGGGACCTGAATATGTCCTTGG - Intronic
1062149798 9:135011882-135011904 AATGGTCCTGATGATGTGCATGG - Intergenic
1189077623 X:37933757-37933779 AAGAGCCCTATATATGTGCATGG - Intronic
1190095171 X:47474019-47474041 AATGGCCCTCAATAGGTGAATGG + Intronic
1193070838 X:77303861-77303883 TAGGTCCCTGAAGGTGTGCATGG - Intergenic