ID: 1105933346

View in Genome Browser
Species Human (GRCh38)
Location 13:25073755-25073777
Sequence TTCCTTCCTCTTTTTGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 1, 2: 8, 3: 85, 4: 574}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105933346_1105933353 -7 Left 1105933346 13:25073755-25073777 CCCCCCTCAAAAAGAGGAAGGAA 0: 1
1: 1
2: 8
3: 85
4: 574
Right 1105933353 13:25073771-25073793 GAAGGAATAAAAGAAGAAAGGGG 0: 1
1: 4
2: 25
3: 462
4: 3193
1105933346_1105933352 -8 Left 1105933346 13:25073755-25073777 CCCCCCTCAAAAAGAGGAAGGAA 0: 1
1: 1
2: 8
3: 85
4: 574
Right 1105933352 13:25073770-25073792 GGAAGGAATAAAAGAAGAAAGGG 0: 1
1: 3
2: 105
3: 1164
4: 7150
1105933346_1105933351 -9 Left 1105933346 13:25073755-25073777 CCCCCCTCAAAAAGAGGAAGGAA 0: 1
1: 1
2: 8
3: 85
4: 574
Right 1105933351 13:25073769-25073791 AGGAAGGAATAAAAGAAGAAAGG 0: 1
1: 16
2: 382
3: 5063
4: 48274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105933346 Original CRISPR TTCCTTCCTCTTTTTGAGGG GGG (reversed) Intergenic
900206651 1:1434580-1434602 TTCCTTCCTCCCTTTCAGGCAGG - Intergenic
900903714 1:5535620-5535642 TTCTTTGCTCTTTTGGAGGGTGG + Intergenic
900965494 1:5955207-5955229 TTCTTTTATCTTTTTGATGGTGG - Intronic
902192071 1:14770857-14770879 TTCCTGCTTCTGTTTGGGGGAGG - Intronic
903255078 1:22091938-22091960 TTCCCTCCTCTTTTTTTTGGGGG + Exonic
903422733 1:23230320-23230342 TTTCTTTTTCTTTTTGAGGCAGG + Intergenic
903464805 1:23544756-23544778 TTACTACCTCTTGGTGAGGGGGG - Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
904339756 1:29827267-29827289 CTCCTTCCTCTTTTTGTCTGAGG + Intergenic
904903983 1:33880275-33880297 TCTCTCTCTCTTTTTGAGGGAGG + Intronic
905184543 1:36187121-36187143 TTCTTTCTTCTTTTTTTGGGGGG + Intergenic
905941216 1:41864981-41865003 TTCCTGCCAGTTTTTGAGGCTGG + Intronic
906985770 1:50681838-50681860 TTTTTTCCTCTTTTTGAGACAGG + Intronic
907843878 1:58185734-58185756 TTCCCCCATCTCTTTGAGGGTGG - Intronic
908135189 1:61124858-61124880 TTCCCTCCTCTCATGGAGGGAGG - Intronic
908475073 1:64479390-64479412 TTCATTCCACTTTCTTAGGGAGG - Intronic
908548988 1:65190435-65190457 TTTCTTCCTTTTTTTGGGGGGGG + Intronic
909023483 1:70458113-70458135 TTCCTTCCTTTTTTGTAGGCTGG + Intergenic
909486260 1:76177901-76177923 CTGCTCCCTCTTTTTCAGGGAGG - Intronic
910480692 1:87655269-87655291 TTTCTTACTCTTTTGGAGGCTGG - Intergenic
910752343 1:90646577-90646599 TTCCCTGCTCTTTTAGAGGTTGG - Intergenic
911121754 1:94303222-94303244 TTCCTTCCTTTTTTTTTGGCTGG - Intergenic
911369561 1:96980294-96980316 TTCCATCCTGATTTTGAGAGTGG - Intergenic
911515422 1:98862559-98862581 TTCCTTCCTCTTTTTTTTGCTGG + Intergenic
911657534 1:100461753-100461775 ACACTTCCTTTTTTTGAGGGAGG - Intronic
912627957 1:111221836-111221858 CCTCTTCCTATTTTTGAGGGTGG - Intronic
913027916 1:114864484-114864506 TTCTTTTCTTTTTTTGATGGGGG + Intronic
913113706 1:115678289-115678311 TTCCTTCCATATTTGGAGGGTGG + Intronic
913185225 1:116364572-116364594 TCCCCTCCTCTTTTACAGGGTGG - Intergenic
914328490 1:146644207-146644229 CTCCTCTCTCTTTTTGAGAGAGG + Intergenic
914776935 1:150745654-150745676 TTTCTTCCCCTTTTTGAGACAGG - Intronic
915103854 1:153520150-153520172 TTTCTTTCTCTTTTTCAGGCTGG - Intergenic
915277717 1:154801029-154801051 TTTCTTTCTCTTTTTGAGCGGGG - Intronic
915337161 1:155151444-155151466 TTCTTTCCTTTTTTTTGGGGGGG - Intergenic
915426677 1:155833345-155833367 TTCCTTCCTTTTTTTGCAGTGGG - Intronic
915803521 1:158819586-158819608 TACATTCCTCTTTTTGTGTGTGG - Intergenic
916676278 1:167066559-167066581 GTCCTACCTGTTTTTGACGGTGG - Intronic
916871367 1:168918178-168918200 CTCCTTCCTCTTTTTCAGCAAGG - Intergenic
917101320 1:171448520-171448542 TTGCTTCCATTTTTTGGGGGAGG - Intergenic
917178000 1:172260958-172260980 TTCCTTCCTTCTTTTGAGACAGG + Intronic
917321373 1:173785499-173785521 TTCTTTTCTTTTTTTGTGGGAGG - Exonic
917881782 1:179344190-179344212 TTCCTTCCTGTTTTTGGGGGAGG + Intronic
917992508 1:180396316-180396338 TTTCTTCCTCTTTTTTATTGTGG - Intronic
918646377 1:186910738-186910760 TTCCTTTCTTTGTTAGAGGGGGG + Intronic
920534903 1:206731116-206731138 TTCCTTCCTCCTGTTGATGCAGG + Exonic
920826019 1:209425014-209425036 TTTTTTCTTCTTTTTGAGGTGGG + Intergenic
921162138 1:212480540-212480562 TTCCCTCCTTTTTTTGAGATGGG + Intergenic
921197857 1:212777364-212777386 TTCCTTTTTTTTTTTGAGGCAGG - Intronic
921342644 1:214149782-214149804 TTGCTCCCTCTCTTTGAGGGTGG - Intergenic
921457722 1:215392644-215392666 TTTATTCCTTTTTGTGAGGGGGG - Intergenic
921783171 1:219193042-219193064 TTCCTTTCTTTTTTTTTGGGGGG + Intronic
923037699 1:230296215-230296237 TGTCTTTCTCTTTTTGAGGCAGG - Intergenic
923108861 1:230875207-230875229 TTTCTTCCTCTTTAAGACGGGGG + Intergenic
923418529 1:233789456-233789478 TTCCTTCCTTTTTTTGAGACAGG - Intergenic
923476513 1:234337493-234337515 TTTCTCCCTCATTTTAAGGGAGG - Intergenic
923788510 1:237091414-237091436 TTCTTTCTTTTTTTTGGGGGGGG + Intronic
1063425054 10:5944209-5944231 TTCTTTCTTATTTTAGAGGGAGG - Intronic
1063698606 10:8362404-8362426 ATCCTTGCTCTTTGAGAGGGAGG + Intergenic
1064862609 10:19844604-19844626 TTCTTTTTTCTTTTTGAGGTAGG + Intronic
1065316164 10:24465837-24465859 GTCCTTCATCTTGTTTAGGGTGG + Intronic
1065345931 10:24748061-24748083 TTCCTCTCTTTTTTTGAGAGAGG - Intergenic
1065518883 10:26552590-26552612 TTCCTTTCTTTTTTAGAGGTAGG - Intronic
1066294264 10:34040611-34040633 TTGCTTCCTCTCTTTGGTGGGGG - Intergenic
1066583437 10:36905769-36905791 TTCCCTCATCTTTTTGAAGAAGG - Intergenic
1066668535 10:37812229-37812251 TTTCTTCCTTTTTTTGAGACAGG - Intronic
1067259360 10:44674569-44674591 TCTTTTCCTCTTTTTGAGGCTGG + Intergenic
1068584663 10:58783379-58783401 TTCCTCCCTCTTTTTTGGTGAGG + Intronic
1069095554 10:64255106-64255128 TTCCTTACCCCTCTTGAGGGTGG + Intergenic
1069677524 10:70259283-70259305 TTCTTTTTTTTTTTTGAGGGGGG - Intronic
1070533009 10:77353954-77353976 ATCCTGCCTCTTTTTTTGGGGGG + Intronic
1070724138 10:78776940-78776962 ATCCTTCCTCTTTCTGATGCTGG - Intergenic
1070806749 10:79275281-79275303 TACTGTCCTCCTTTTGAGGGTGG + Intronic
1071089000 10:81897531-81897553 ATCCCTCCTCTTATTGAGGACGG - Intronic
1071107804 10:82118669-82118691 TTTTTTGCTTTTTTTGAGGGGGG + Intronic
1071970579 10:90902221-90902243 TTTCTTCTTCTTTTTGAGACAGG + Exonic
1072351686 10:94563490-94563512 TTCTTTTCTTTTTTTGAGGCAGG + Intronic
1073086042 10:100889750-100889772 TTCGTACCTCTTTTTGAGGCAGG + Intergenic
1073128156 10:101165548-101165570 TTCCTTCCTTTTTTGGGGGTGGG + Intergenic
1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG + Intronic
1073888573 10:108070223-108070245 TTCCTTCCTTCTTGTGAGGGTGG + Intergenic
1074338750 10:112605393-112605415 TTCCTTCTACTTTTCCAGGGAGG + Intronic
1074463475 10:113660555-113660577 TATTTTCCTCTTTTTGAGGTGGG - Intronic
1074927831 10:118091815-118091837 TTCCTGCCTCCTTTTTAGGCAGG - Intergenic
1075074949 10:119344558-119344580 TTCCCTGCTCTTTTTGGGGATGG + Intronic
1075160637 10:120021777-120021799 CTCCTTACTTTTTTTTAGGGGGG + Intergenic
1075840461 10:125497818-125497840 TTCCTTCCGTTTTTTGAGATAGG - Intergenic
1076929060 10:133515921-133515943 TTCCTTAGTTTTTTTGTGGGGGG + Intergenic
1077086096 11:751996-752018 TTCCTTTCTCTCTTCAAGGGAGG + Intronic
1077448428 11:2616493-2616515 ATCCTTCTTCTTTTTCAGTGTGG + Intronic
1077649605 11:3958335-3958357 TTCCTTTTTATTTTTGAGAGGGG - Intronic
1078139589 11:8682645-8682667 TCGCTTCCTCTTTCTGAGGGTGG - Exonic
1079055488 11:17202566-17202588 TTCTTTTTTTTTTTTGAGGGAGG - Intronic
1079737712 11:24017691-24017713 GTCTTTCCTCTTTTTGAGTCAGG - Intergenic
1079940343 11:26672614-26672636 TTCCTCCCTCTTGTTGAGGGTGG + Intronic
1081392661 11:42547280-42547302 TTCCTTCCTTTTGTCAAGGGTGG - Intergenic
1081466914 11:43328723-43328745 TTTCTGCCTCTTCTGGAGGGAGG - Exonic
1081606439 11:44530028-44530050 AGCCTTCCTCTTTTTCAGGTAGG - Intergenic
1082046060 11:47728539-47728561 TTCCTTTTTCTTTTTGAGACAGG + Intronic
1082075820 11:47975452-47975474 TTCTTTCCTTTTTTTGAGATAGG + Intergenic
1082973041 11:59043592-59043614 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1082974545 11:59059166-59059188 TTCCTTTCTCTCTTGGTGGGGGG - Intergenic
1082977435 11:59087156-59087178 TGCCTACCTGTTTTTGAGGTCGG - Intergenic
1083025635 11:59548433-59548455 TTTCATCATCTTTTTGGGGGGGG - Intergenic
1083969564 11:66066313-66066335 TTCCTTTCTTTTTTTGAGAGAGG + Intronic
1084446516 11:69206676-69206698 TTCCTTCCTTTTTTTGAGACAGG + Intergenic
1085061225 11:73448979-73449001 TTTCTTTCTCTTTTTGAGATGGG + Intronic
1085167501 11:74416404-74416426 TTTCTTTCTTTTTTTTAGGGGGG + Intergenic
1085337218 11:75705513-75705535 TTTCTACCTCTTTTTTGGGGCGG - Intergenic
1085450827 11:76631310-76631332 TTCCTCTCTCTTTTTTGGGGGGG + Intergenic
1086328061 11:85724914-85724936 TTTCTTCCACTTCCTGAGGGAGG + Intronic
1086589076 11:88490324-88490346 GTCTTTCTTCTTTTTGAGGCAGG - Intergenic
1087104156 11:94393979-94394001 TTCTTTCCTCTTCTGGAGGTGGG - Intronic
1087142294 11:94776573-94776595 TTGCTTTCTCTTTGTGAGGTAGG + Intronic
1088058924 11:105620894-105620916 TTCTTTCCATTTTTTGGGGGGGG + Intronic
1088251232 11:107862414-107862436 TTCCCTCCTTTTTTTGGTGGTGG - Intronic
1088251257 11:107862610-107862632 TTCCCTCCTTTTTTTGGTGGTGG - Intronic
1088620079 11:111672587-111672609 TTCCTTCCTCTTCTAGTGGAAGG - Intronic
1088779816 11:113123497-113123519 TCCCTTCCTGTATTTTAGGGTGG + Intronic
1088942774 11:114477529-114477551 TTCTTTCCTTTTTTTGTGGAGGG - Intergenic
1089437877 11:118486416-118486438 TTCCTTCCTCATTGTAAAGGTGG - Intronic
1089711433 11:120317606-120317628 TTCCATCCTTACTTTGAGGGTGG + Intronic
1090637124 11:128696169-128696191 GTCCTTCCTTTTTTTGTGGGTGG + Intronic
1090675073 11:128984367-128984389 TTCCTTTTTTTTTTTGAGGCAGG - Intronic
1091011523 11:132005709-132005731 TCCTTTTCTCTTTTTGAGAGAGG + Intronic
1091145735 11:133278312-133278334 TTTCTTTTTCTTTTTTAGGGGGG + Intronic
1093027411 12:14257677-14257699 TTTCTGCCTCTTTGTTAGGGCGG - Intergenic
1093084584 12:14852477-14852499 CTCCTTCTTCTTTTTGAGATAGG + Intronic
1093219241 12:16399275-16399297 TTACTTCCTCTTTTTCTTGGGGG + Intronic
1093737332 12:22636156-22636178 TTCTTACCTTTTTTTGAGAGAGG - Intronic
1093750816 12:22797818-22797840 TTCCTTTTTTTTTTTGAGGCTGG - Intergenic
1095080918 12:37998513-37998535 TTCCTTCCACTTTTTAACTGGGG - Intergenic
1096559678 12:52426605-52426627 TTCTTTCCTCTTTGAGAGTGAGG - Intronic
1096945438 12:55402431-55402453 TACCTTCATCTATTTGATGGTGG - Intergenic
1096972736 12:55681057-55681079 TTCTTTCCTTTTTTTGAGACAGG - Intergenic
1097271818 12:57780237-57780259 CTCCTTCCTCTCTCTCAGGGGGG + Exonic
1097644686 12:62222307-62222329 TTGATTACTCATTTTGAGGGAGG - Intronic
1098465392 12:70781127-70781149 TTCCTACGTCTTTTTCAGGCAGG + Intronic
1098567966 12:71956613-71956635 TTCCTTCCTTTTTTTGAAACAGG + Intronic
1098772113 12:74565629-74565651 CTTCCTCCTCTTTTTGGGGGTGG - Intergenic
1099723194 12:86391045-86391067 TTTCTTTCTCATTTTGTGGGAGG + Intronic
1099926619 12:89026707-89026729 TTCTTTCTTTTTTTTGGGGGGGG + Intergenic
1100272921 12:93043541-93043563 CTCCTTCCTTTTTTTGAGACAGG + Intergenic
1100622405 12:96291295-96291317 TTTCTTCCTCTTTTTGAGACAGG + Intronic
1100843579 12:98637714-98637736 TTCTTTCCTTTTTTTGAGACAGG + Intronic
1100989854 12:100240160-100240182 TTCCTTCTTTTTTTTGAGACAGG + Intronic
1101097225 12:101355016-101355038 TTTCTTCCTTGTTTTGAGGAAGG - Exonic
1101150572 12:101878910-101878932 TTTTTTCCTTTTTTTGGGGGTGG + Intronic
1101254504 12:102964266-102964288 TTACTTCATCTTTTTGAGACAGG + Intergenic
1101831749 12:108263275-108263297 TTCCTTCCTCCTTTTGAGTCTGG + Intergenic
1101855315 12:108437690-108437712 TTTCTACCTCTTTTCCAGGGAGG + Intergenic
1102182815 12:110924967-110924989 TTCCATCCTTTTTTTTTGGGGGG + Intergenic
1102361737 12:112293894-112293916 TTTCTTTCTTTTTTTGTGGGCGG + Intronic
1102741037 12:115207694-115207716 TTCCTTCCTGTTTTAGATGGAGG + Intergenic
1103018927 12:117518283-117518305 TTCCTTCCTCTTTTTTCCTGGGG + Intronic
1103251835 12:119506604-119506626 TTCTTTTCTCTTTTTGAGACAGG - Intronic
1103364748 12:120373694-120373716 TTTCTTTCTTTTTTTGAGGCAGG + Intergenic
1103410008 12:120704330-120704352 TTTTTTCCTCTTTTTGAGGCCGG + Intergenic
1104246913 12:127052059-127052081 TTCTTTCCTGTTTTGGAGAGAGG - Intergenic
1104700080 12:130896485-130896507 TTCTTTCCTTTTTTTGAGGCAGG + Intergenic
1104828161 12:131729496-131729518 TTCTTTCTTCTTTTTGAGACAGG - Intronic
1105335180 13:19460454-19460476 TTCATTCCTCTTTGTGAGCGCGG + Intronic
1105560326 13:21484569-21484591 TTCCTTCTTTTTTTTGGGGGAGG + Intergenic
1105859738 13:24398932-24398954 TTCATTCCTCTTTGTGAGCGCGG - Intergenic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1106236240 13:27862917-27862939 TTCCTTCCTTTCTTTGAGATGGG - Intergenic
1106367348 13:29094227-29094249 TTCCCTCTTCTTTTTTTGGGTGG + Intronic
1106443413 13:29801132-29801154 TTCCTTCCTCAGCTTGAGGGTGG - Intronic
1106758346 13:32844344-32844366 CTCCTTCCTCTTTCCCAGGGTGG + Intergenic
1107035203 13:35894950-35894972 TTCCTTTTTCTTTTTGAGACAGG + Intronic
1107078473 13:36348291-36348313 TTCCTTTCTTTTTTTGGTGGGGG - Intronic
1107477772 13:40756430-40756452 TTCCTTCTTCTCATTGATGGTGG + Intronic
1107537343 13:41348671-41348693 TTCTCTCCTCTTTTTTTGGGGGG + Intronic
1109078417 13:57866682-57866704 TTTCTTTCTCTTTTTGAGACAGG + Intergenic
1109314898 13:60738922-60738944 TTACTCCCTCTTTTTGAGATGGG + Intergenic
1109436636 13:62311899-62311921 TTTCTTTCTTTTTTTGGGGGGGG - Intergenic
1109828631 13:67756484-67756506 TTCCTTCCTTTTGTTCAGGTTGG + Intergenic
1110083654 13:71348616-71348638 ATGCTCCATCTTTTTGAGGGTGG - Intergenic
1111016567 13:82388781-82388803 TTCTTTCATCATTTTGAGGCAGG + Intergenic
1111152352 13:84271585-84271607 TTCCTTTCTTTTTTTGCGGTTGG + Intergenic
1111215182 13:85132365-85132387 TTACTTCTTCTTTTTATGGGTGG + Intergenic
1111337923 13:86846684-86846706 TTCCTTCCTCAGCTGGAGGGTGG - Intergenic
1112347292 13:98600839-98600861 TTTCTTGCCTTTTTTGAGGGGGG - Intergenic
1112371964 13:98802120-98802142 TGCCTTCCTGTTTCTGAGGAAGG + Intronic
1113734504 13:112668643-112668665 TTCCTTGTTCTTTTTGAGGCAGG + Intronic
1114180474 14:20362890-20362912 TTCCTTTCTTTTTTTGAGACTGG - Intergenic
1114298548 14:21352673-21352695 TTACTTCCTCTTTTTCTTGGGGG + Exonic
1114585728 14:23811882-23811904 TTTCTCTCTCTTTTTGAGGCAGG + Intergenic
1115410361 14:33067206-33067228 ATCCATCCTCTATTTGAGGATGG + Intronic
1115410612 14:33069942-33069964 TACGTGCCTCTTTTTGAAGGTGG + Intronic
1115772047 14:36674183-36674205 TTTCTTCCACTTTTTGAGAATGG - Intronic
1116229915 14:42203116-42203138 TTCCTTTTTTTTTTTGGGGGGGG - Intergenic
1116396604 14:44454522-44454544 TTTCTGCCCCTTTTTGAGGTTGG - Intergenic
1116453394 14:45089472-45089494 TTCTTTCTTTTTTTTGAGGCAGG + Intronic
1117034002 14:51707996-51708018 TTCTTTCATCATTTTGGGGGTGG + Intronic
1117410543 14:55446967-55446989 TTCCTCCCCCTTTTTGGTGGAGG + Intronic
1117543700 14:56772957-56772979 TTCCTTCATCTTTAAAAGGGGGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118054183 14:62062282-62062304 TTAGTTTCTCTATTTGAGGGGGG + Intronic
1118321766 14:64757631-64757653 TCCCTTCCTCTCTGGGAGGGGGG + Intronic
1118413803 14:65511013-65511035 TTTCTTCCTTTTTTTGATGTAGG + Intronic
1118524636 14:66625085-66625107 CTTCTTCTTCTTTTTGAGGCAGG + Intronic
1118814885 14:69304049-69304071 TTCCGGGCTCTTTTTGGGGGTGG + Intronic
1121243614 14:92447353-92447375 CTCCTTTCTCTCTTTGAGGTGGG + Exonic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1121578063 14:95004588-95004610 TTCTTTTCTTTTTTTGAGGCAGG - Intergenic
1123980940 15:25601993-25602015 TTCCTTCTTTTTTTTAAGGCTGG + Intergenic
1124375930 15:29128650-29128672 TTTCTTACTCTTTAAGAGGGTGG - Intronic
1125096042 15:35853102-35853124 TTTCTTCCTTTTTTTTGGGGGGG - Intergenic
1125475054 15:40041635-40041657 TTCCTTTTTCTTTTTGAGGCAGG + Intergenic
1125605445 15:40937546-40937568 TTCCTTCTGCCTTTTGTGGGAGG + Intronic
1126621031 15:50640267-50640289 TCACTTCTTTTTTTTGAGGGAGG + Intronic
1126660456 15:51028068-51028090 TTTCTTCCTTTTTGTGAAGGTGG + Intergenic
1127164405 15:56229831-56229853 TTCCTTCCTTTTTGGGTGGGGGG - Intronic
1127483285 15:59396807-59396829 TTCCTTTTTCTTTTTGAGACAGG + Intronic
1127594472 15:60465195-60465217 TTCCTTCCTTTTTCTGAGACAGG + Intronic
1127992693 15:64132585-64132607 TTCTTTCCTCTGTCTTAGGGAGG - Intronic
1128312667 15:66641068-66641090 TTCTTTCCTTTTTTTGAGACAGG - Intronic
1128839952 15:70842048-70842070 TTCTTTTCTCTTTTTGAGACTGG + Intronic
1129021817 15:72526557-72526579 TTCCTACTTCTTTTTAAAGGCGG - Intronic
1129064138 15:72886912-72886934 TTTCTTCCTTTTTTTGCGAGGGG - Intergenic
1129241864 15:74256705-74256727 TTTTTTGCTCTTTTTGAGGCTGG - Intronic
1129634886 15:77305135-77305157 TTCCTTCCTTTTTTTGAAACAGG - Intronic
1129857486 15:78834970-78834992 TTTCTTTCTTTTTTGGAGGGTGG - Intronic
1130052245 15:80493521-80493543 TTTCTTCCTCTTTATGTGGCAGG + Intronic
1130319282 15:82826900-82826922 TACTTTCATCTTTTTTAGGGTGG - Intronic
1130383812 15:83394164-83394186 TTCCTTTTTCTTTTTGAGACAGG - Intergenic
1130538112 15:84801492-84801514 TTTCTTTTTCTTTTTGAGGCAGG - Intronic
1130673650 15:85934087-85934109 TTCCTTCCAGTTTTTTTGGGGGG + Intergenic
1130862950 15:87907752-87907774 TTCCTTCCACTTTTTGCTTGGGG - Intronic
1131083843 15:89559090-89559112 TTCTTTTCTTTTTTTGAGGCAGG + Intergenic
1131096643 15:89659393-89659415 TTCCTTCTTCTTTTTGAGACAGG - Intergenic
1131244338 15:90777152-90777174 TTCCTTTTCTTTTTTGAGGGGGG + Intronic
1131315765 15:91335689-91335711 TTCCTTCAACTTTTTTAGGTAGG + Intergenic
1131498867 15:92940439-92940461 TTCCTTTTTCTTTTTGAGACAGG - Intronic
1131692720 15:94844807-94844829 GCCCTTCCGCTTTTGGAGGGTGG + Intergenic
1131818468 15:96246866-96246888 TACCTTCTTTTTTTTGAGGTAGG - Intergenic
1132199644 15:99942548-99942570 CTTCTTCCTTTTTTTGGGGGAGG + Intergenic
1133291324 16:4723427-4723449 TTTCTTTTTCTTTTTGAGGCAGG + Intronic
1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG + Intronic
1133802576 16:9095848-9095870 TTCCTTCCTTTTTTGGAAAGGGG - Intronic
1133843604 16:9433519-9433541 TTTCTTCCTCTTTTTGTTTGTGG + Intergenic
1134180937 16:12047109-12047131 TTCTTTCCTCTCTGTGAGGTGGG + Intronic
1135307674 16:21380871-21380893 TTCTTTCCTCTCTGTGAGGTGGG + Intergenic
1135614915 16:23902807-23902829 TTCCTTCCTTTTTTTGAGATAGG + Intronic
1136304418 16:29359991-29360013 TTCTTTCCTCTCTGTGAGGTGGG + Intergenic
1137434541 16:48444907-48444929 TTTTTTCCTTTTTTTGAGAGAGG + Intronic
1137441451 16:48501934-48501956 TTCCTTCCTCATGATGAGGATGG - Intergenic
1137726428 16:50659701-50659723 TCCTTTCCTCTATTAGAGGGCGG - Intergenic
1138814655 16:60190335-60190357 TTCCTTTTTCTTTTTGAGACGGG - Intergenic
1138954660 16:61956424-61956446 TTCTTTCCTCTTTTTCAAGATGG - Intronic
1139459558 16:67110694-67110716 TTCCTTCCCCTTTTTAGGAGGGG + Intronic
1140005075 16:71066735-71066757 CTCCTCTCTCTTTTTGAGAGAGG - Intronic
1140023603 16:71262896-71262918 TTCCTGCCTCTTTCTGGGGTAGG - Intergenic
1140222355 16:73053183-73053205 TTCTTTTCTTTTTTGGAGGGGGG + Intronic
1140544600 16:75794581-75794603 TGGCTTCCTCTTTTTGAGAGTGG - Intergenic
1140773101 16:78224006-78224028 TTCCTTCTTTTTTTTGAGACTGG + Intronic
1141025403 16:80541577-80541599 TTCTTACCTCTTTTTCTGGGGGG - Intronic
1142080160 16:88144853-88144875 TTTTTTTCTCTTTTTGAGGCGGG + Intergenic
1142423538 16:89988134-89988156 TTTTTTCCTTTTTTTGAGAGAGG - Intergenic
1142988771 17:3714938-3714960 TTCCTTCCTTTGTTTCAGTGTGG - Exonic
1143191005 17:5040177-5040199 TTCCTTCTTTTTTTTGAGACAGG + Intronic
1143784061 17:9243872-9243894 TTCTTTCCTTTTTTTTGGGGGGG + Exonic
1146734753 17:35229014-35229036 TTCCTTCCTTTTTTTCTGGGAGG - Intergenic
1147122108 17:38341663-38341685 TTCTTTCCTGTGGTTGAGGGAGG + Intronic
1147418776 17:40311749-40311771 TTCCTTCCTCCTTTGTGGGGAGG + Intronic
1147607141 17:41780389-41780411 TTCTTTCCTTTTTTTGAGGTAGG - Intronic
1147992900 17:44345788-44345810 TTACTTCCTCTTGTTGCGGGTGG + Intronic
1148092735 17:45032383-45032405 GTCATCCCTCTTTTGGAGGGAGG + Intronic
1148665336 17:49370611-49370633 TTCCTTCCTTTTTTTTGGGGGGG - Intergenic
1150004084 17:61458965-61458987 TTCCTTTCTTTTGTTGAGGGTGG + Intronic
1150077016 17:62201186-62201208 TTTCTTTCTTTTTTTGAGAGAGG + Intergenic
1150138331 17:62708090-62708112 TTTCTTTCTCTTTTTGAGACAGG - Intronic
1150576783 17:66437717-66437739 TTCCTTTTTTTTTTTGAGCGGGG + Intronic
1150947394 17:69762913-69762935 TTTTTTCCTTTTTTGGAGGGTGG + Intergenic
1152624832 17:81383457-81383479 TCCCTTCCTCTTGGTCAGGGCGG + Intergenic
1153255881 18:3170765-3170787 TTTCTTCCTCTCTTTCAGGTGGG + Intronic
1153361726 18:4205496-4205518 TTCCTTTCTCTTTTTGAGACAGG + Intronic
1153544478 18:6191999-6192021 TTTCTTTTTTTTTTTGAGGGGGG - Intronic
1154389461 18:13923956-13923978 TTCCTTCTCCTTTTCCAGGGAGG - Intergenic
1154938112 18:21081955-21081977 TTTTTTCCTTTTTTTGAGGCAGG + Intronic
1155323677 18:24644528-24644550 TCCATTCCTTTTTTTGAGGGGGG - Intergenic
1156856180 18:41783789-41783811 TTCCTCCCTCTTTGTGATGATGG + Intergenic
1156952546 18:42920053-42920075 TTCCTTACCCTTTTGGTGGGAGG - Intronic
1157378648 18:47190709-47190731 TTCCTTCCTCTCTTTGAAACTGG - Intergenic
1157617261 18:48994586-48994608 TTGCTTCCTCCTTTTGTTGGCGG - Intergenic
1157658545 18:49417556-49417578 TTCCTCACTCTTTTTAATGGGGG - Intronic
1157847509 18:51017570-51017592 CTCCCTCCTCCTTTTCAGGGAGG - Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1157982282 18:52395443-52395465 TCTCTTCATCCTTTTGAGGGTGG - Intronic
1158093555 18:53744284-53744306 TTCCTTCCACCTTGTGAAGGAGG - Intergenic
1158708271 18:59814391-59814413 TTTCTTTCTTTTTTTGGGGGGGG + Intergenic
1159516054 18:69459103-69459125 TTCCTTCCTTTTTTTTGGGGGGG - Intronic
1159622760 18:70657532-70657554 TTCCCTCTTTTCTTTGAGGGAGG - Intergenic
1159695786 18:71554313-71554335 TTTCTTTCTTTTTTTGGGGGGGG + Intergenic
1159931921 18:74321308-74321330 TTCCTTCCTTTTTTTGAGACAGG + Intronic
1162861641 19:13510006-13510028 TTCCTTCCTTTTGTAGAGGCAGG - Intronic
1163021064 19:14480974-14480996 TTCCTTTCTCTTTTTGAGACAGG + Intronic
1163703203 19:18797171-18797193 TTCTTTCTTGTTTTTGAGGTAGG + Intergenic
1164491219 19:28715856-28715878 GTTCTTCCTCTTTTTGATGTAGG - Intergenic
1164816087 19:31204436-31204458 TTCTTTCCCCTTTTTGGGGGAGG + Intergenic
1165171697 19:33896705-33896727 TTCCTTCCTTTTTTTTATGATGG - Intergenic
1165467247 19:35982302-35982324 TTCCTTGCTCTTTTTTTGGAGGG - Intergenic
1165503268 19:36207061-36207083 CTCCTTCCTCTTGTTGATCGAGG - Intronic
1166674953 19:44734674-44734696 CTCCTTCTTCTTTTTGAGACAGG + Intergenic
1166899000 19:46043951-46043973 TTCATTCCTCTCTGTGAGTGCGG - Intronic
1167878364 19:52433359-52433381 TTTCTTTCTCTTTTTGGGGGGGG + Intronic
1168136814 19:54357365-54357387 TCCCTTCCTCTTGTTGCGGGTGG - Intronic
1168482306 19:56731395-56731417 TTCTTTCCTTTTTTTGAGACAGG + Intergenic
1168641246 19:58033320-58033342 TTCTTTCTTTTTTTTGGGGGTGG + Intergenic
925324307 2:3005618-3005640 TTCCTTGCTCTACTTCAGGGTGG + Intergenic
925575638 2:5357314-5357336 TTCCTTACTTTTTTTAACGGAGG + Intergenic
925594646 2:5543298-5543320 CTCCTTCCGCTTTTTGAAGAAGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
926417664 2:12665656-12665678 TTCCTTCCTCTACTTCAGAGGGG + Intergenic
926693547 2:15754410-15754432 CTCCTTCGTCTTTTTGGGTGTGG + Intergenic
928035057 2:27815211-27815233 TTCCCCCCTCTTTTTGAGACAGG + Intronic
928752545 2:34487617-34487639 TTCCTTCCTCTTTCTGCAGTGGG - Intergenic
928793180 2:34983557-34983579 TTACTTCCTCTTTTCCAGTGTGG + Intergenic
929626008 2:43407677-43407699 TTCCTTCCTTCTTTTTAGCGTGG - Intronic
930001247 2:46863093-46863115 TTCCTACCCCTTTTTCAGTGAGG + Intergenic
930007690 2:46911021-46911043 TTTCTTCCTTTTTTTGGTGGTGG - Intronic
931240312 2:60446479-60446501 GTCCTTCCTTTTTCAGAGGGAGG + Intergenic
932101336 2:68902052-68902074 TTCTTTTCTTTTTTTGGGGGGGG - Intergenic
932495349 2:72143358-72143380 TCCCTTCCTCTTTCGGGGGGGGG + Intronic
933484111 2:82896653-82896675 TTCCTTCCCCATTTCAAGGGCGG - Intergenic
933522665 2:83392796-83392818 TTTCTCCCTTTTTTGGAGGGGGG + Intergenic
933660422 2:84923084-84923106 TTCCTTCTTTTTTTTGAGACAGG - Intergenic
935689607 2:105719044-105719066 CTGCTTCCTCTGCTTGAGGGAGG - Intergenic
937196633 2:120163265-120163287 TTTCTTTCTTTTTTTGGGGGGGG - Intronic
938592871 2:132756348-132756370 TTTCTGCAACTTTTTGAGGGAGG - Intronic
938868496 2:135449761-135449783 TTTCTTTCTTTTTTTGAGGCAGG + Intronic
939726217 2:145724596-145724618 TTCTTTCCTTTTTTTGAGACAGG + Intergenic
940164989 2:150761200-150761222 TTCCTTCCTTTATTTGTGAGAGG - Intergenic
940345531 2:152624159-152624181 TTCCTTCCTCTTTTTTGAGATGG + Intronic
940707711 2:157125537-157125559 TTCCTTCCCCTGCCTGAGGGAGG - Intergenic
942208864 2:173650614-173650636 TTCCTTCTTTTTTTTGAGACAGG - Intergenic
942270216 2:174266972-174266994 TTCTTTCTTTTTTTTGGGGGGGG + Intergenic
942428706 2:175886425-175886447 TACTTTCCTGTTTTTGGGGGTGG - Intergenic
942855927 2:180547772-180547794 TTGCTTCATATTATTGAGGGGGG + Intergenic
943937570 2:193940806-193940828 TGCCCTCCTCTTTTTGAAGCTGG - Intergenic
944736678 2:202573050-202573072 TTCTTTCTTTTTTTTGGGGGGGG - Intergenic
944977700 2:205075463-205075485 TTCCTTTTCTTTTTTGAGGGTGG - Intronic
945980734 2:216308396-216308418 TTCTTTTCTCTTTTTGAGAGAGG - Intronic
945980959 2:216310265-216310287 TTCTTTTCTTTTTTTGAGGTAGG + Intronic
946318708 2:218935232-218935254 TTCTTTTCTTTTTTTGAGGTAGG + Intergenic
946497390 2:220208295-220208317 TTTCTTCCTGTGTTTGATGGGGG + Intergenic
946892234 2:224289717-224289739 TTCTTTCTTTTTTTTGGGGGTGG + Intergenic
946916949 2:224532883-224532905 TTCCCTCCTCTTTTAGTGGAGGG - Intronic
947065112 2:226216090-226216112 TTCCTTCCTCTTCCTCAAGGGGG + Intergenic
947328230 2:229000644-229000666 TTCCTGCCACTTTTTGAAGAAGG + Intronic
948229893 2:236342067-236342089 TTCCTGCCTCTTATTGCGGGAGG + Intronic
1169571458 20:6911236-6911258 TTCCTTTCTTTTGTTGGGGGTGG - Intergenic
1169868717 20:10228740-10228762 TCCCTTCCTCTTTCTCAGAGTGG - Intronic
1170193707 20:13669276-13669298 TTCTTTCTTTTTTTTGGGGGGGG + Intergenic
1170224871 20:13981242-13981264 TTTCTTTCTTTTTTTTAGGGGGG - Intronic
1171187159 20:23130587-23130609 TTCCTTGCTACTTTTCAGGGAGG - Intergenic
1172151930 20:32796828-32796850 TTCCACCCTCTCTTTGAGGGGGG + Exonic
1172372117 20:34401745-34401767 CCCCCTCCTCTTTTTTAGGGGGG - Intronic
1173055607 20:39609452-39609474 TTTCTTCCTATTTATGAGGATGG - Intergenic
1174159514 20:48541057-48541079 TTCCTTTATCTTTATGTGGGTGG + Intergenic
1174230114 20:49039567-49039589 TTCTTTCCTCTTTTGGTGGAAGG - Intergenic
1174651243 20:52127521-52127543 TTCCTGCCTCTTTGTGAAGAAGG + Intronic
1174739481 20:52998167-52998189 TGCCTTCTTCTTTTTTTGGGGGG + Intronic
1174823073 20:53744167-53744189 TTCCTTCCTTTTTTTGAGACAGG + Intergenic
1175146894 20:56903801-56903823 TTTCTTCCTGTATTTGAGGGAGG + Intergenic
1176448967 21:6846088-6846110 TTCTTTTCTCTTTTTTTGGGGGG + Intergenic
1176738395 21:10574532-10574554 TTCATTCCTCTTTGTGAGCGCGG - Intronic
1176827137 21:13711111-13711133 TTCTTTTCTCTTTTTTTGGGGGG + Intergenic
1177262619 21:18750142-18750164 ATCCTTTCTCTTTTTGAGCCTGG - Intergenic
1177813064 21:25945702-25945724 TTTCTTCCTTTTTTTGAGACAGG + Intronic
1178068966 21:28940183-28940205 TTCCTTGTTCTTTTTGAGACAGG + Intronic
1178780049 21:35594190-35594212 TTTTTTCCTTTTTTTGAGGGAGG + Intronic
1179032031 21:37729320-37729342 ATTCTTCTTCTTTTTGGGGGGGG + Intronic
1179968666 21:44821235-44821257 TTCCCTTTTCTTTTTGAGGTGGG - Intergenic
1180700869 22:17780880-17780902 TTCCATGCTCTTCTTGAGGGTGG + Intergenic
1180878795 22:19188925-19188947 TTCCTTCTTTTTTTTGGGGCGGG + Intronic
1180897147 22:19344596-19344618 TTCCTACCTATTTTGGAAGGAGG - Intronic
1181585563 22:23851269-23851291 TTCCTTCCTTTTTTTGAGATAGG + Intergenic
1181657133 22:24311958-24311980 TTTCTGCCTCTTTTTTTGGGGGG + Intronic
1181687854 22:24541953-24541975 TTCCTTCCTCTTTTTTGGGGAGG - Intronic
1181977251 22:26738607-26738629 TTCTTTCTTCTTCTTGAGGCAGG + Intergenic
1183768735 22:39904380-39904402 TTTTTTCCTCTTTTTGAGACAGG - Intronic
1184677549 22:46052071-46052093 TTCTTTTCTCTTTTTGAGATGGG - Intronic
1184981842 22:48100729-48100751 TTCCCGCCTCTTTCTCAGGGTGG - Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
949553449 3:5131887-5131909 TTCTTTCCTTTTTTTGAGACAGG + Intronic
950269039 3:11598493-11598515 TTCCTTCCTTTTTTAGAGGCAGG + Intronic
950554509 3:13687139-13687161 TTCCTTCCTCCTTGTGTGGAGGG + Intergenic
950717476 3:14859883-14859905 TTTCTTTCCCTTTTTGGGGGGGG - Intronic
950833340 3:15896800-15896822 TCCCTTCCTCTTAGTGTGGGTGG + Intergenic
951378633 3:21955369-21955391 TTCCTCCCTATTTTTGGGGGTGG - Intronic
951459842 3:22939166-22939188 TTCCTTGCTCTTGTACAGGGTGG - Intergenic
951489324 3:23251300-23251322 GTTCTTCATCTTTTTGAGGGGGG - Intronic
951720146 3:25689383-25689405 TTTCTTCCTTTTTTTGCGAGGGG - Intergenic
952736456 3:36696168-36696190 TTCCCTCCTTTTTTTGTGGAAGG + Intergenic
953646763 3:44762431-44762453 TTTCTTTCTCTTTTTCACGGAGG + Intronic
953673382 3:44981254-44981276 TTCCTGCCTCTTTTTGAATGAGG + Intronic
953801634 3:46028595-46028617 TTCCTTTTTTTTTTTGAGGCAGG + Intergenic
954085871 3:48243434-48243456 TTCCATCCACTCTTTGAGGGTGG + Intronic
954719004 3:52543839-52543861 TTTCTTTCTTTTTTTGGGGGGGG - Intronic
954787564 3:53105419-53105441 GACCTTACTCTTTTTGGGGGGGG - Intronic
955179777 3:56656595-56656617 TTTCTTTCTTTTTTTGGGGGGGG - Intronic
955206451 3:56900017-56900039 TTCCTTCCCCTTTTTGGGAGGGG + Intronic
955323753 3:57993820-57993842 TTCTTTTTTCTTTTTGAGGCAGG - Intergenic
955388107 3:58496115-58496137 TTCCTGCCTTTTTTTGGTGGGGG + Intronic
955461399 3:59187498-59187520 TTCTTTCTTTTTTTTGGGGGGGG - Intergenic
955864860 3:63371878-63371900 TTCCTTCCCCATCCTGAGGGTGG - Intronic
955925189 3:63997328-63997350 TCTCTTCCCGTTTTTGAGGGAGG + Intronic
955993811 3:64657340-64657362 TTACTTTTTCTTTTTGAGGCAGG + Intronic
956795962 3:72719159-72719181 TTCCTTTCTATTTTTGAGACTGG - Intergenic
957763857 3:84595026-84595048 TTCCTTTTTTATTTTGAGGGGGG - Intergenic
958473182 3:94548419-94548441 TTGCTTCCTCTCTGTGAGAGTGG - Intergenic
959159419 3:102705813-102705835 TTCTTTTTTCTTTTGGAGGGGGG + Intergenic
960136409 3:114110143-114110165 TTCCTTTCTCTTTGTTTGGGTGG + Intergenic
960218493 3:115073470-115073492 TTATTTTCTCTTTTTGAGAGAGG - Intronic
960390419 3:117071253-117071275 TTCATTCTTATTTTAGAGGGAGG + Intronic
960962073 3:123078396-123078418 TTCTTTCCTTTTTTTTAGGCAGG + Intronic
961849998 3:129806571-129806593 TTCCTTCTCCTATTTGAGAGAGG - Intronic
962159096 3:132980085-132980107 GTCCTCCCTTTTTTTGATGGGGG - Intergenic
962581093 3:136798724-136798746 TTCTTTCCTTTTTTTGAGATGGG + Intergenic
965182525 3:165423061-165423083 TTCCTTCTTCTCTATCAGGGAGG - Intergenic
965256487 3:166420088-166420110 ATTCTTCCTATTTTTGAGCGTGG + Intergenic
965374563 3:167907178-167907200 TTGCTTTCTCTTTTGGAGGTGGG + Intergenic
966268237 3:178072379-178072401 TTCTTTCCTTTCTTTGGGGGTGG - Intergenic
966389011 3:179431957-179431979 TTTCTTTTTCTTTTTAAGGGAGG - Intronic
966470225 3:180280982-180281004 TTCCTTTCTCCCTTTGAGGATGG + Intergenic
966679001 3:182620304-182620326 TTTCTTCCTCTTTTTTTGGGTGG - Intergenic
966748149 3:183297696-183297718 TTCTTTCCTTTTTTTGAGACAGG + Intronic
968771100 4:2507858-2507880 TTCTTTTCTCTTTTTGAGACAGG + Intronic
970010617 4:11454859-11454881 TTCCTTCTTCTTCTTGAGGCAGG - Intergenic
970019925 4:11556761-11556783 TTTCTCCCTCTTTTTGAGCTGGG - Intergenic
970161434 4:13193252-13193274 TTGCTTCCTCTTCTTGAGCTGGG + Intergenic
970252991 4:14136334-14136356 TTCATACCACTTTTTGAGGTAGG + Intergenic
970879790 4:20915331-20915353 CTCATTACTTTTTTTGAGGGAGG + Intronic
971038793 4:22726937-22726959 TTCCCTCCTCTTTTTTTGGGGGG - Intergenic
971204735 4:24553784-24553806 TTTCTTTTTCTTTTTGGGGGTGG - Intronic
971258763 4:25036833-25036855 TTCCATCCTCTTTGTTAAGGGGG + Intergenic
971711219 4:30115190-30115212 TTCCTTGCTCTTTTTAAATGGGG - Intergenic
971775608 4:30960437-30960459 TTCCTACTGCTTATTGAGGGTGG + Intronic
972192300 4:36609694-36609716 TTCCTTCCCCTCTGTGAAGGTGG - Intergenic
972750307 4:41981521-41981543 TTCCTTTCTCTTTTTGAGACAGG - Intergenic
972997429 4:44898363-44898385 TTCTTTCTTTTTTTTGGGGGTGG + Intergenic
973244753 4:47999410-47999432 TTCCTTCCCCTCTTTTAAGGAGG + Intronic
973325640 4:48858160-48858182 TTTCTTCCTTTTTTTGGCGGGGG - Intronic
973544435 4:51966359-51966381 TTCTTTCTTTTTTTTGAGGCAGG + Intergenic
973555762 4:52081125-52081147 TTCCTTTCTCCTTTAGAGGATGG + Intronic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
974150463 4:58000969-58000991 TTCTTTTCTCTTTTTGATGCTGG + Intergenic
974419226 4:61650621-61650643 TCCTTTCTTTTTTTTGAGGGTGG + Intronic
974945586 4:68524532-68524554 TACCTTCTACTTTTTGTGGGAGG + Intergenic
975048885 4:69834312-69834334 TTCCTCCCTTTGTTTGAGGCAGG - Intronic
975406611 4:73998071-73998093 TTCCTTCCCGTTCTTCAGGGAGG + Exonic
975431269 4:74293997-74294019 ATCCTTCTTCTTTTTGGGGGAGG + Intronic
975551777 4:75620387-75620409 TTCCCTCCATTTTTTGAGGTTGG - Intronic
975621641 4:76302726-76302748 TTTCTTTTTCTTTTTGGGGGGGG + Intronic
976566086 4:86552413-86552435 TTCCTTCCTCTCTTTGAGACAGG - Intronic
976677640 4:87720982-87721004 TTCTTTCTTTTTTTTGAGGCAGG + Intergenic
978470922 4:109066658-109066680 TTTCTTCCTTTTTTTGAGACAGG + Intronic
979221738 4:118234406-118234428 TTCTTTTCTTTTTTTGAGAGAGG - Intronic
979820798 4:125167877-125167899 TTCTTTCTTTTTTTTGGGGGGGG - Intergenic
979917288 4:126452282-126452304 TTTCTCCCTTTTTTTGGGGGCGG - Intergenic
979959603 4:127001666-127001688 TTCCTTCCTTCTTTTGAGACAGG - Intergenic
981119947 4:141038683-141038705 TTCTTTTTTTTTTTTGAGGGAGG - Intronic
981139204 4:141248910-141248932 TCTCTTCCTCTTCTTGTGGGTGG - Intergenic
981984099 4:150832773-150832795 TTCCTTCTTTTTTTTGAGACAGG + Intronic
982441485 4:155441256-155441278 TTCCTTCTCTTTTTTGAGGCAGG - Intergenic
982926945 4:161349853-161349875 TTCATTCCTCTTTGTGACCGTGG + Intergenic
983537291 4:168871733-168871755 TCCCAGCCTCTTTTTGGGGGAGG - Intronic
983927504 4:173417632-173417654 TTCCTTCTTTTTTTTCAGAGAGG + Intergenic
984634959 4:182101037-182101059 TTCCTTCCTTTTTTTGAGACAGG - Intergenic
984840780 4:184065436-184065458 TTTCTTCCTTTTTTTGAGATAGG + Intergenic
985244406 4:187965272-187965294 TTTCTTCCTTTTTTTGAGAGAGG - Intergenic
985888373 5:2697493-2697515 TTCCTTCTTCTTCTTAAGGCCGG - Intergenic
986350800 5:6877952-6877974 TTCCTTCTTCTTCTGTAGGGAGG + Intergenic
988018467 5:25592369-25592391 TTTCTTCTTCTTTTTGAGATGGG - Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
988827031 5:34948042-34948064 TTAATTCCTTTTTTTGGGGGAGG - Intronic
988829031 5:34969705-34969727 TTCCTTCCTCCTGGTCAGGGAGG + Intergenic
989390303 5:40893747-40893769 TTGCTTTGTCCTTTTGAGGGAGG + Intergenic
990061048 5:51648996-51649018 TTCCTTCAGCTTTTTCAGGTTGG + Intergenic
990289792 5:54338064-54338086 TTCCTTCCTCTTTTGCAATGTGG - Intergenic
990409030 5:55522068-55522090 TTCCTGAGTCTTTTTCAGGGTGG - Intronic
990590119 5:57253941-57253963 TTTCTTTCTTTTTTTGAGGCAGG + Intronic
992017643 5:72592189-72592211 TTCCCTCCTCTCTTTGAGACTGG - Intergenic
992661980 5:78970958-78970980 TTTCTTTCTCTTTTTGAGACAGG - Intronic
992925070 5:81574844-81574866 TTTATTCTGCTTTTTGAGGGAGG - Intronic
993850165 5:92998752-92998774 TTCCATCTTCATTTTGATGGAGG - Intergenic
994010141 5:94892501-94892523 TTTTTTCCTCTTTTAGGGGGAGG - Intronic
994523582 5:100874576-100874598 TTTCTTCCTTTTTTTGAGACAGG + Intronic
994640140 5:102397526-102397548 TTCCTGGCTTTTTTTGAGGTCGG + Intronic
994881988 5:105509723-105509745 TTTCTTCCTTTTCTTGTGGGAGG + Intergenic
994946617 5:106401951-106401973 TTCCTTCCTCATTATTTGGGAGG + Intergenic
994983961 5:106911908-106911930 TTTCTTCCTCTTGTAGAGTGTGG - Intergenic
995368880 5:111396025-111396047 CTCCTTCCTGTTTTTGATGTGGG - Intronic
995557124 5:113341233-113341255 TTTCTTTCTTTTTTTGAGGCAGG + Intronic
995634912 5:114176942-114176964 TTCCTTTTTCTTTTTAAAGGAGG + Intergenic
996156335 5:120107388-120107410 TTTCTTCCTTTTTTTGAGACAGG + Intergenic
996286562 5:121800535-121800557 TTACTTCTTCTTTTTGAAAGAGG - Intergenic
997117893 5:131145729-131145751 TTTCTTTCTCTTTTTGAGACAGG + Intergenic
997318932 5:132962557-132962579 TTCCTTCCACTCTTTGAGGATGG - Intronic
998410314 5:141905300-141905322 TTTCTTTCTCATTTTTAGGGGGG - Intergenic
998651247 5:144124135-144124157 TGCATTCCTCCTTTAGAGGGTGG + Intergenic
998721442 5:144955445-144955467 TTCCTGACTCTTTTACAGGGAGG - Intergenic
999216061 5:149936146-149936168 TTCCTTCCTTTTTTAGAGACAGG - Intronic
999372714 5:151065608-151065630 TCCCTTCCCCTCTCTGAGGGAGG + Intronic
999446853 5:151647037-151647059 TTCCTTCTTTTTTTTGAGTCAGG + Intergenic
999452263 5:151687085-151687107 TTTCCTCCTCTTTTTGCGGTGGG + Exonic
1000373484 5:160558806-160558828 TTCCTTGCTCTTTAAGAGGAGGG + Intergenic
1000672057 5:164075341-164075363 ATCCTTGCTCTTTTTGAACGTGG + Intergenic
1000692879 5:164344805-164344827 TACCTTCCACTATTTGAGAGAGG + Intergenic
1000898942 5:166890030-166890052 TTTCTTGCTGTTTTTCAGGGGGG - Intergenic
1002205935 5:177562568-177562590 TTCTTAGCACTTTTTGAGGGAGG + Intergenic
1003364734 6:5461562-5461584 CTACTTCCTTTTTTTGAGAGGGG + Intronic
1004055397 6:12132188-12132210 TTCCTTCCTGGTCCTGAGGGAGG + Intronic
1004107567 6:12679921-12679943 TTCTTTTCTTTTTTTGAGAGAGG + Intergenic
1004873567 6:19932408-19932430 TTTCTTCTTCTTCTTGAAGGTGG + Intergenic
1005819166 6:29582875-29582897 CTCCTTCCTCTTCTTCAGGGTGG - Intronic
1006231204 6:32588446-32588468 TTTTTTTCTCTTTTTGAGGTAGG - Intronic
1007039362 6:38707524-38707546 TTCTTTCCTTTTTTTGAGACAGG - Intergenic
1008275845 6:49543434-49543456 TTACTTCCTCTTCCTGAAGGAGG - Intergenic
1008508080 6:52250201-52250223 TTCTTTTTTCTTTTTGAGAGAGG - Intergenic
1009878465 6:69535594-69535616 TTCCTGCCTGGTTTTGAGTGAGG - Intergenic
1010040006 6:71370203-71370225 TTCTTTCTTTTTTTTGGGGGGGG + Intergenic
1010653330 6:78480431-78480453 TGCCTTCCTCTTATGGAGGGTGG - Intergenic
1011270400 6:85572946-85572968 TTTCTTCCTTTTTTTGAGACAGG - Intronic
1011555496 6:88568182-88568204 TTTCTTCTTCTTTTTGAGACAGG + Intergenic
1011717970 6:90126970-90126992 TTCCTTCCTCCCTTTAAAGGGGG + Intronic
1012036700 6:94150563-94150585 TTCTTTCCTTTTTTTGTGGTTGG + Intergenic
1012384414 6:98662271-98662293 TTCTTTCATGTTTTTCAGGGTGG + Intergenic
1012594049 6:101020004-101020026 TTTCTTCCCCTTCTTGAGGAAGG + Intergenic
1012893077 6:104919191-104919213 TTCTGCCCTCATTTTGAGGGGGG - Intergenic
1013183217 6:107735422-107735444 TTTCTTTCTGTTTTTGAGGGCGG + Intronic
1013779617 6:113715454-113715476 TTCTTTCTTCTTTTTTTGGGGGG - Intergenic
1013838251 6:114358750-114358772 TGCCTTCATCTATTTGAAGGAGG - Intergenic
1015741277 6:136456664-136456686 TTCTTTCTTCTTTTTGAGACAGG - Intronic
1016593593 6:145773590-145773612 TTCTTTTCTTTTTTTGTGGGGGG + Intergenic
1016921340 6:149297529-149297551 TTTCTTTCTCTTTTTGAGATTGG + Intronic
1017172422 6:151470484-151470506 TTCCTTGCTCTTTTTCATGGGGG - Intergenic
1018330795 6:162725755-162725777 TTTTTTCCTCTTTTTGAGACAGG - Intronic
1018777170 6:167028244-167028266 TTCCCTCCTGTTTCTGAGTGGGG + Intronic
1018847503 6:167565847-167565869 TTCCTTTTACTTTTTTAGGGTGG + Intergenic
1019134995 6:169902416-169902438 TTCCTTCCCCTGTTGGTGGGAGG - Intergenic
1022817158 7:33924663-33924685 TTTCTTTCTTTTTTTGAGAGGGG + Intronic
1023738574 7:43256836-43256858 TTCTTTCTTTTTTGTGAGGGAGG - Intronic
1023792561 7:43764770-43764792 TTACTTCTTTTTTTTGCGGGGGG - Intronic
1024273095 7:47657064-47657086 TTCTTTCTTTTTTTTGCGGGGGG - Intronic
1024904099 7:54356457-54356479 TTCCCTCCTCTTTGTCAAGGAGG - Intergenic
1024955962 7:54921045-54921067 CTCCTTCATGTTTTTGAGGGAGG - Intergenic
1025018509 7:55462543-55462565 TTTCTTCTTCTTTTTTTGGGGGG + Intronic
1025984534 7:66436835-66436857 TTCCTTTCTTTTTTTGAAGCAGG - Intergenic
1026401694 7:70020695-70020717 TTCCTTTTTCTTTTTGAGGTAGG + Intronic
1026465500 7:70650129-70650151 TTCCTTCCTGTCTGTGAGTGTGG - Intronic
1026711444 7:72743899-72743921 TGCCTCTCTCTTTTTGGGGGTGG - Intronic
1027207685 7:76115124-76115146 TTCCTTTCTTTTTTTGAAGCAGG - Intergenic
1027735792 7:81931518-81931540 TTCCTTCTAGTTTTGGAGGGAGG + Intergenic
1028472881 7:91223945-91223967 TTCTTTCTTTTTTTTGCGGGGGG - Intergenic
1028604865 7:92644670-92644692 TTCCTTCCTCTTTTTCAGGGTGG - Intronic
1028917609 7:96276615-96276637 TTCCCTCCTTCTTTTGAGGCAGG - Intronic
1029485552 7:100837663-100837685 TTCCTTTCTTTTTTTGAGACAGG + Intronic
1029692101 7:102189345-102189367 TTCCTTCTTTTTTTTGGGTGCGG + Intronic
1030452821 7:109733998-109734020 TTTCTAGCTCTTTATGAGGGAGG - Intergenic
1030547641 7:110917583-110917605 TTCTTTCCTATTTTTGCTGGAGG - Intronic
1030938476 7:115615941-115615963 ATACTTACTTTTTTTGAGGGGGG + Intergenic
1031431350 7:121674220-121674242 TTACATCCTTTTTTTGGGGGGGG + Intergenic
1032058101 7:128700096-128700118 TTCCTTTCTCTTTTTGAAATGGG + Intergenic
1032256526 7:130301699-130301721 GTCGTTTCTCTTCTTGAGGGAGG + Intronic
1032313117 7:130807098-130807120 TTCCTCCTGCATTTTGAGGGTGG - Intergenic
1033552550 7:142460638-142460660 TTTCTCCCTCTTTGTGAGTGGGG - Intergenic
1033737427 7:144236702-144236724 TTTCTTTCTCTTTTTGAGGCAGG + Intergenic
1033745629 7:144314245-144314267 TTTCTTTCTCTTTTTGAGGCAGG - Intergenic
1033760634 7:144433036-144433058 TTTCTTTTTTTTTTTGAGGGGGG - Intergenic
1034120072 7:148619058-148619080 TTCTTTCTTCTTTTTGAGACAGG - Intergenic
1034920712 7:155078959-155078981 TTTCTTTCTTTTTTTGAGGCAGG + Intronic
1035905047 8:3500255-3500277 TTGGTTCCTCTTTGTGAAGGAGG + Intronic
1036284750 8:7434408-7434430 TTCTTTCTTTTTTTGGAGGGGGG + Intergenic
1036336724 8:7877122-7877144 TTCTTTCTTTTTTTGGAGGGGGG - Intergenic
1036412196 8:8512603-8512625 TTCCTTCCTTTTTGTCAGAGTGG - Intergenic
1036563938 8:9922031-9922053 TTAATTCCTCTTTTTGGAGGTGG - Intergenic
1037437302 8:18876390-18876412 TTTCTTCCTTTTTTTGAGACAGG + Intronic
1038582552 8:28762023-28762045 CCCCTTCCTCTTTTTGATAGAGG + Intergenic
1038701409 8:29852866-29852888 CTCCTTCCTGTTTCTGAGGCTGG - Intergenic
1038975876 8:32695333-32695355 TTCCTTCTTTTTTCTGAGAGAGG - Intronic
1039441411 8:37597928-37597950 TTCCTTCCTCCTGGTGATGGGGG - Intergenic
1039607329 8:38892348-38892370 TTTCTTTCTTTTTTTGAGAGAGG + Intergenic
1042164172 8:65929735-65929757 ATCCTTCCTTTTCTGGAGGGTGG - Intergenic
1042496524 8:69460581-69460603 TTCCTTTCTCATTTTAAGGAAGG - Intergenic
1043296876 8:78675771-78675793 TTCCTTCCTGTTTTAGAGAATGG + Exonic
1043442900 8:80292113-80292135 TTCTTTCCTTTTTTTGAGACAGG + Intergenic
1043717009 8:83499455-83499477 TAACTTCCTTTTTTTGAGTGTGG + Intergenic
1043780193 8:84324302-84324324 TTCCTTCATCTTTATGACTGAGG + Intronic
1044972130 8:97630052-97630074 TTCTTTCTTCTTTTTGAGACAGG - Intergenic
1044986811 8:97763160-97763182 TTTCTTCCTTTTTTTGTGGGGGG + Intergenic
1045983469 8:108219826-108219848 TTTCTTTCTTTTTTTGAGGCAGG - Intronic
1046172291 8:110526211-110526233 TTTCTTTCTCTTTTTTTGGGGGG - Intergenic
1047101102 8:121676612-121676634 TTTCTTTCTTTTTTTGAGAGAGG + Intergenic
1047561043 8:125988452-125988474 TTTCTTCCTCTTCTTTAAGGGGG - Intergenic
1048101774 8:131359545-131359567 TTGCTTCCTCTCTGTGAGGGTGG + Intergenic
1049104746 8:140605099-140605121 TTTTTTCTTCTTTTTGAGGTGGG + Intronic
1049846041 8:144802025-144802047 TTCTTTCCTTTTTTTGAGACAGG - Intronic
1050290019 9:4144199-4144221 TTCTTTCCTCCTTTGGACGGAGG - Intronic
1050853761 9:10323307-10323329 TCCCTTCCTCTTTTTCAGATGGG + Intronic
1051044557 9:12857430-12857452 TTCCTTCCCTTTTTTGAGACAGG - Intergenic
1051270072 9:15346954-15346976 TTTCTTACTGTTTTTGAGGTTGG - Intergenic
1051516991 9:17940805-17940827 TTCTTTCTTTTTTTTGGGGGGGG - Intergenic
1051886840 9:21902356-21902378 TTCCTTCCTCTTTTGCAGGTAGG - Intronic
1052108874 9:24554494-24554516 TTCTTCCCTTTTTTTAAGGGAGG + Intergenic
1052337322 9:27333451-27333473 TTCCTTCCTCTCTGAGAGTGTGG + Intronic
1052613573 9:30808927-30808949 TTCATTTCTCTTTTTGAAGTGGG - Intergenic
1052684669 9:31740087-31740109 TGCCTTCCTCTTTTTCCGTGTGG + Intergenic
1052812425 9:33073389-33073411 TTCTTTCCTTTTTTTGAGACTGG - Intronic
1052923894 9:33997032-33997054 TTTCTTCTTTTTTTTGAGGGGGG - Intronic
1053136426 9:35653328-35653350 TTTCTTTCTTTTTTTGGGGGTGG - Intergenic
1053178549 9:35947544-35947566 TTCCTTCTTCTTTTTGAGACAGG - Intergenic
1053455232 9:38228410-38228432 TTCCTTCCTTTTTTAAAGGAAGG + Intergenic
1055037786 9:71836764-71836786 TTTCTTTCTTTTTTTGAGGCAGG - Intergenic
1055073804 9:72193875-72193897 TTCCTTCCCCTTTTTGAAGGTGG + Intronic
1055816942 9:80217963-80217985 TTCCTTACCCATTTTGGGGGAGG + Intergenic
1056184872 9:84124726-84124748 TTCCTTTCTCTTTCTTAGCGGGG - Intergenic
1056699389 9:88889385-88889407 ATCCTTTCTCTTTTTGGGGGGGG + Intergenic
1057770484 9:97963201-97963223 TTCTTTTCTTTTTTTGGGGGGGG - Intergenic
1057849466 9:98553583-98553605 TTTTTTCCTCTTTTTGAGAAGGG - Intronic
1057979651 9:99647750-99647772 TTCTTTCTTCTTTTTGAGACAGG - Intergenic
1058767467 9:108195882-108195904 TTTCTTTTTCTTTTTGAGGCAGG + Intergenic
1058904931 9:109474900-109474922 ATCCTTCCTCTTTTATAGGTAGG - Intronic
1059008578 9:110431581-110431603 TTCCTTGCTCTGATTGAGGCAGG + Intronic
1059164303 9:112064032-112064054 TTTCTTTCTTTTTTTGGGGGGGG + Intronic
1059613835 9:115927452-115927474 TTCCTGCCACCTTTTGAGGAAGG + Intergenic
1060618206 9:125038235-125038257 TTCTTTTCTTTTTTTGAGGTAGG - Intronic
1061468313 9:130801233-130801255 TTCCTTTCTTTTTTTGAGATAGG + Intronic
1061592943 9:131609900-131609922 TTCCTTTCTTTTTTTGAGACAGG + Intronic
1061888223 9:133603836-133603858 TTCTTTTCTTTTTTTGGGGGAGG + Intergenic
1203520221 Un_GL000213v1:38429-38451 TTCTTTTCTCTTTTTTTGGGGGG - Intergenic
1203360520 Un_KI270442v1:216988-217010 TTCCCTCCTGTTTTTGCGGGTGG + Intergenic
1185690018 X:2146956-2146978 TTTTTTCCTTTTTTTGGGGGGGG + Intergenic
1185845376 X:3432893-3432915 TTTCTTTTTCTTTTTGAGAGAGG + Intergenic
1187070758 X:15885697-15885719 ATCCATCCTCTTTTTGAGGGGGG + Intergenic
1187157353 X:16733400-16733422 TTCCATCCTCATTCTGTGGGTGG - Intronic
1188266645 X:28085108-28085130 AGCCTTCCTGTTTTTCAGGGGGG - Intergenic
1188308148 X:28584526-28584548 TTCCACCCTCCTTTGGAGGGAGG + Intergenic
1188700771 X:33259602-33259624 TTCCTTTTTTTTTTTGGGGGGGG - Intronic
1188812750 X:34672074-34672096 TTCCTTCTTTTTCATGAGGGAGG - Intergenic
1189116622 X:38349710-38349732 TTCCTCACTCTTTGTGTGGGTGG - Intronic
1189490897 X:41471107-41471129 TACCTTCTTTTTTTGGAGGGGGG + Intronic
1189753040 X:44242232-44242254 TTCCTTTCTATTTTTGGAGGAGG + Exonic
1190833656 X:54081166-54081188 TTTCTTTCTCTTTTTGAGATGGG - Intronic
1191105721 X:56770901-56770923 TACCTTCCTCTTTTTGGGGGGGG + Intergenic
1191106714 X:56776303-56776325 TACCTTCCTCTTTTTGGGGGGGG + Intergenic
1191578974 X:62739182-62739204 TTCTTTCTACTTTTTCAGGGGGG + Intergenic
1191734359 X:64373698-64373720 ACCTTTCCTCTTTTAGAGGGTGG - Intronic
1192178118 X:68898614-68898636 CTCTTTCTTCTTTTTCAGGGAGG + Intergenic
1192718832 X:73670305-73670327 TTCATTCCTCTCCTTGAGAGTGG + Intronic
1193036936 X:76961408-76961430 TTCTTTCCTCATTATGAGGATGG + Intergenic
1193252598 X:79309456-79309478 TTCCTTCCTCTTTCCAAAGGGGG - Intergenic
1193690551 X:84636017-84636039 TTCTTTCTTCTTTTTGAGACAGG - Intergenic
1194019310 X:88667404-88667426 TTCCTCCCTCTCTTTCAGGGAGG - Intergenic
1194389382 X:93297419-93297441 TTCCTTCAACTTTTAGAGGAGGG + Intergenic
1194396480 X:93393314-93393336 TTTTTTTCTTTTTTTGAGGGGGG - Intergenic
1196682270 X:118481338-118481360 TTCTTTTCTTTTTTTGAGAGAGG + Intergenic
1197301502 X:124787526-124787548 TTCCAACATCTTTTTGATGGAGG - Intronic
1197343750 X:125306426-125306448 TTCCTTTTTTTTTTTGGGGGGGG - Intergenic
1197988575 X:132293345-132293367 CTCTTTCCTCTTTTTGAGGATGG + Intergenic
1198426703 X:136528098-136528120 TTTCTTCCTTTTTTTGAGATAGG + Intergenic
1198710298 X:139494571-139494593 TTCTTTGCTGATTTTGAGGGGGG - Intergenic
1199107294 X:143884902-143884924 TTTCTTTATTTTTTTGAGGGGGG + Intergenic
1199753157 X:150840194-150840216 TTCTTTTTTCTTTTTGAGGTAGG - Intronic
1199986178 X:152953268-152953290 TTCCTAGCTCTTTTTGAGTGGGG - Intronic
1200761674 Y:7044630-7044652 TTCTTTCCTTTTTTTGTGGGGGG + Intronic
1201268393 Y:12230858-12230880 TTCTTTCCTTTTTTGGGGGGTGG - Intergenic
1202068377 Y:20964021-20964043 TTCCTTACTCTTGTTAAGGCAGG - Intergenic