ID: 1105934285

View in Genome Browser
Species Human (GRCh38)
Location 13:25084963-25084985
Sequence AGACAACTGCTACCAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105934285_1105934295 24 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934295 13:25085010-25085032 GGGTTAAGGGACCTTAGTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 65
1105934285_1105934290 3 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934290 13:25084989-25085011 GACCTTATTCAGGATCTGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 89
1105934285_1105934288 -7 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934288 13:25084979-25085001 GTTGTCTGTTGACCTTATTCAGG 0: 1
1: 0
2: 0
3: 9
4: 91
1105934285_1105934294 11 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934294 13:25084997-25085019 TCAGGATCTGGCTGGGTTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 156
1105934285_1105934293 10 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934293 13:25084996-25085018 TTCAGGATCTGGCTGGGTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 179
1105934285_1105934291 4 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934291 13:25084990-25085012 ACCTTATTCAGGATCTGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 98
1105934285_1105934289 -1 Left 1105934285 13:25084963-25084985 CCCTTCCTTGGTAGCAGTTGTCT 0: 1
1: 0
2: 2
3: 41
4: 239
Right 1105934289 13:25084985-25085007 TGTTGACCTTATTCAGGATCTGG 0: 1
1: 0
2: 3
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105934285 Original CRISPR AGACAACTGCTACCAAGGAA GGG (reversed) Intergenic
901641914 1:10696928-10696950 AGACAAAGGCTACAGAGGAATGG + Intronic
904063923 1:27733256-27733278 AGTCAACTGTTACCAAACAAAGG - Intronic
906472531 1:46143140-46143162 AGAAAAATACTACCAATGAAGGG - Intronic
906815261 1:48872104-48872126 AGTCAACTGCAACCAAGAACTGG + Intronic
907732910 1:57085350-57085372 AGACAACTGCGCCCAAGTGAGGG + Intronic
908062889 1:60371142-60371164 AGAAAATTGATACCAAGGAGTGG + Intergenic
908681570 1:66667580-66667602 AGAAAATTGCTGCCAAGGCAAGG + Intronic
909104627 1:71392901-71392923 AGATAATTGGTACCAAGGAGAGG + Intergenic
909542447 1:76806197-76806219 AGAAAATTGATACCAAGAAATGG + Intergenic
910262768 1:85307844-85307866 AAACACCTGCTACCAGGTAAGGG + Intergenic
910266503 1:85343391-85343413 AGGCAACTGCTGCCAGGAAAAGG + Intronic
912086713 1:106014965-106014987 AGAAAATTGGTACCAAGGAGTGG - Intergenic
912809664 1:112784488-112784510 AGAAAACTGGTACCAAGGAGTGG - Intergenic
913051573 1:115121155-115121177 AGAAAATTGGTACCAAGGAGTGG - Intergenic
916514835 1:165506558-165506580 AGACACCTGCTATCAAAGATCGG + Intergenic
919311553 1:195916540-195916562 AGAAAATTGGTACCAAGGAATGG + Intergenic
919874175 1:201849979-201850001 ATACATGTTCTACCAAGGAAAGG + Intronic
920603491 1:207354292-207354314 AGAAAACTGAGACCAAGAAAGGG - Intronic
920777906 1:208958336-208958358 AGAAAATTGATACCAAGGAAAGG + Intergenic
920891223 1:209987247-209987269 AGAAAACTGGTACCAAGGAGTGG - Intronic
922616139 1:226962223-226962245 TGCCAGCTGCCACCAAGGAAAGG - Intronic
922902070 1:229144931-229144953 AGACACCTTCTACCTGGGAAAGG + Intergenic
923858842 1:237872575-237872597 AGGCAGGTGCTACCATGGAAAGG + Intergenic
924034456 1:239922166-239922188 ATACAACTGCCTTCAAGGAAAGG + Intergenic
1063423799 10:5935744-5935766 ACACATCTGCTGCCCAGGAAAGG - Intronic
1065071713 10:22031847-22031869 GGAAAATTGGTACCAAGGAATGG - Intergenic
1066696009 10:38078237-38078259 AGAAAATTGGTACCAAGGAGTGG - Intergenic
1067783239 10:49224210-49224232 AGAAAACTGGTACCAAGGAGTGG - Intergenic
1070082844 10:73205890-73205912 AGAACACTGGTACCAAGGAATGG + Intronic
1070583177 10:77739584-77739606 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1071276246 10:84058296-84058318 TGACTGCTGCTACCAAGGGATGG - Intergenic
1071950436 10:90697394-90697416 AGACAGCTGCAAACAAGGAAGGG - Intergenic
1072940754 10:99761439-99761461 AGACAACTGGTACCAAGGAGAGG - Intergenic
1075184665 10:120245033-120245055 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1078025122 11:7687843-7687865 AGACATCTGCAAACCAGGAAGGG - Intergenic
1078135856 11:8650899-8650921 GGTCAAATGCAACCAAGGAAGGG + Intronic
1079833392 11:25300306-25300328 AGAAAATTGGTACCAAGGACTGG + Intergenic
1079919810 11:26418899-26418921 AGAAAACTGGTACCAAGGGGTGG + Intronic
1081784215 11:45735255-45735277 AGACAATGGCTTCAAAGGAAGGG + Intergenic
1084114238 11:67032578-67032600 GGAAAACTGAGACCAAGGAAGGG - Intronic
1087456150 11:98389169-98389191 ATACCACAGCTACCAAAGAAAGG + Intergenic
1087849343 11:103010377-103010399 AGAGAATTGGTACCAAGGAGTGG - Intergenic
1088058432 11:105612466-105612488 AGAGAACTGAAACCAAGCAATGG + Intronic
1088506332 11:110531341-110531363 AGGCAACTGCAGCCAAGGAGAGG - Intergenic
1091269089 11:134293087-134293109 AGACAAGTGCTGTCAGGGAAGGG - Intronic
1092724684 12:11473935-11473957 AGAAAATTGGTACCAAGAAATGG + Intronic
1093881077 12:24405390-24405412 AGAAAACTGTTGGCAAGGAAGGG + Intergenic
1095727957 12:45473172-45473194 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1095843033 12:46715165-46715187 AGAAAATTGGTACCAAGGAATGG - Intergenic
1096046643 12:48568328-48568350 GGAAAATTGCTACCAAGGAGCGG + Intronic
1097372882 12:58805661-58805683 ATACAACTGCTACAAAAGATTGG + Intronic
1097754337 12:63392095-63392117 ATACAACTGTTAGCATGGAAAGG - Intergenic
1099587038 12:84532245-84532267 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1099800116 12:87446239-87446261 TGACAACTGCTACAAGGCAAAGG - Intergenic
1103543972 12:121686521-121686543 AGAGAATTGCCACCAAAGAAAGG + Intergenic
1104797814 12:131531840-131531862 AGACAGGTGTTTCCAAGGAAAGG - Intergenic
1105807750 13:23966912-23966934 AGACAGCTGCTATCAAAGGAAGG + Intergenic
1105934285 13:25084963-25084985 AGACAACTGCTACCAAGGAAGGG - Intergenic
1106290235 13:28354394-28354416 AGATAACTAGAACCAAGGAAGGG - Intronic
1107105115 13:36634821-36634843 AAACCACTGCTACAAAGGAAGGG - Intergenic
1107168518 13:37312456-37312478 AGCCAATTGCCACCAGGGAAAGG - Intergenic
1107879126 13:44817617-44817639 AGGAAACTGCTAGAAAGGAATGG - Intergenic
1107972403 13:45655929-45655951 AGAAAATTGATACCAAGGAGTGG - Intergenic
1109961972 13:69643568-69643590 AGAAAACTGGTACCAAGAAATGG + Intergenic
1111102406 13:83605444-83605466 AGATAATTGGTACCAAGGAGTGG + Intergenic
1111463512 13:88576898-88576920 AGAAAATTGGTACCAAGAAACGG - Intergenic
1111479831 13:88810281-88810303 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1112067781 13:95813101-95813123 AGAAAATTGGTACCAAGGAGTGG + Intronic
1115312007 14:31988156-31988178 AGAAAATTGGTACTAAGGAATGG + Intergenic
1118408268 14:65449172-65449194 AGACAACTTCACCAAAGGAAGGG + Intronic
1119561457 14:75593243-75593265 AGACAATTTGTACCAAGGAGTGG - Intronic
1120415392 14:84213069-84213091 AGACAATAGCTAGCAAGGAATGG - Intergenic
1121005301 14:90486901-90486923 AGAAAACTGCTAGCAGAGAAGGG + Intergenic
1125156818 15:36596988-36597010 AAACAGATGCTAACAAGGAAAGG - Intronic
1126685920 15:51248891-51248913 AGACAACTGGAAGCAAAGAAAGG - Intronic
1127484302 15:59405156-59405178 ACCTAACTGCTAACAAGGAAAGG - Intronic
1127768465 15:62210746-62210768 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1130795910 15:87209161-87209183 AGACAAATGCTAAGAAAGAATGG + Intergenic
1132485328 16:187356-187378 AGCCAACTGTCTCCAAGGAAAGG - Intergenic
1133644860 16:7754577-7754599 AGAAAACTGGTACCAAGGAGTGG - Intergenic
1135233220 16:20729240-20729262 AGAAAACTGCTGCCACGGTAAGG + Intronic
1136704969 16:32179552-32179574 AGACAAAAGCTAGAAAGGAAAGG + Intergenic
1136762943 16:32749857-32749879 AGACAAAAGCTAGAAAGGAAAGG - Intergenic
1136805157 16:33120529-33120551 AGACAAAAGCTAGAAAGGAAAGG + Intergenic
1138168736 16:54829317-54829339 AGACAACCTCTGCAAAGGAATGG - Intergenic
1139190038 16:64852306-64852328 AGACAAATGATACCAAGTGAGGG - Intergenic
1139950553 16:70666268-70666290 GGAGAACTGCTACCATAGAAGGG + Intronic
1203065095 16_KI270728v1_random:1010177-1010199 AGACAAAAGCTAGAAAGGAAAGG - Intergenic
1143450431 17:7033348-7033370 AGAAAACTGGTACCAAGAAGTGG - Intergenic
1143457073 17:7075234-7075256 AGACAACAGCAAGCTAGGAAGGG + Intronic
1144331031 17:14224395-14224417 AAACAACTTCTACAAAGGCATGG - Intergenic
1145012898 17:19379664-19379686 TGACAACAGCTACCAAGTATTGG - Intronic
1146224354 17:31052745-31052767 AGACACCTTCTATGAAGGAAAGG + Intergenic
1146382730 17:32342900-32342922 AGAAAACTGGTACCAGAGAATGG - Intronic
1146532098 17:33616796-33616818 ACACAACTGCTGCTAAAGAATGG - Intronic
1147630109 17:41924746-41924768 AGATAACTGCTGCCCAGGAGTGG - Intronic
1149853114 17:60053414-60053436 AGAAAATTGGTACCAAGGAATGG + Intronic
1150870885 17:68910266-68910288 ACACAGCTGCTGCCAAGGATGGG - Intronic
1152479911 17:80543957-80543979 AAACTACTGCTACCAAGAAGTGG + Intergenic
1153578910 18:6551269-6551291 AGAAAATTGGTACCAAGGAGTGG - Intronic
1156789338 18:40952836-40952858 AGAAAATTGGTACCAAGGATGGG + Intergenic
1157206459 18:45704292-45704314 AGAAAATTGGTACCAAGGACTGG - Intergenic
1159625159 18:70684756-70684778 AGAAAACTGCTAAAAAGAAATGG - Intergenic
1161731877 19:5965610-5965632 AGCCTACTGCAAGCAAGGAAAGG + Intronic
1164489238 19:28691558-28691580 AGAAAACTGGTACCAAGGAGTGG + Intergenic
1164851311 19:31486554-31486576 AGAAAATTGTTACCAAGGAGTGG - Intergenic
1165962550 19:39547519-39547541 CTTCAACTGCTACCAAGCAAGGG - Intergenic
1166160525 19:40949358-40949380 AGACAACTGGTGCCATGGAAGGG - Intergenic
1166169405 19:41016951-41016973 AGACAACTGGTGCCATGGAGGGG - Exonic
1166573016 19:43810995-43811017 ACACAAATGCTGCCAAAGAAAGG - Intronic
927101367 2:19790002-19790024 TGACACCTGCTATCAAGGGACGG - Intergenic
929541840 2:42828821-42828843 AGACAACTGACACCCATGAAAGG - Intergenic
931801036 2:65757794-65757816 AGAAAATTGGTACCAAGGAGTGG - Intergenic
932919725 2:75897450-75897472 AGACAACAGATACAAAGCAACGG + Intergenic
935057621 2:99581347-99581369 AGACCACTGCTCCCAAGTGAGGG + Intronic
936893305 2:117397102-117397124 AGAACACTGCAGCCAAGGAAAGG + Intergenic
937327779 2:121002102-121002124 AGAAAATTGGTACCAAGGATTGG + Intergenic
938250803 2:129814108-129814130 AGAAAATTGGTACCAAGGAGAGG + Intergenic
940139759 2:150481144-150481166 AGTCAACTTCTAGAAAGGAAGGG + Intronic
940729896 2:157376470-157376492 AGAAAATTGGTACCAAAGAATGG - Intergenic
942091263 2:172493713-172493735 AGAAAACTGAATCCAAGGAAAGG + Intronic
942408681 2:175683708-175683730 AGACAACTGCTCCTAAGTAGAGG + Intergenic
943271434 2:185810619-185810641 AGAAAATTGGTACCAAGGAGTGG + Intronic
944319507 2:198321841-198321863 AGACATCTTCTCCCATGGAAAGG - Intronic
1168997790 20:2145774-2145796 AGACAGCTGCCCCCAAGGAAAGG - Exonic
1169165209 20:3416859-3416881 AGAAAATTGTTACCAAGGACTGG - Intergenic
1169871346 20:10251686-10251708 AGACAAAAGCCACCCAGGAAAGG - Intronic
1170055096 20:12193354-12193376 TGACAAATGTTACCAAGGAGAGG + Intergenic
1171818816 20:29813714-29813736 AGAAAATTGGCACCAAGGAATGG - Intergenic
1171942774 20:31347887-31347909 ATGCAGCTGCTACCAAGGGATGG - Intergenic
1173016853 20:39233806-39233828 AGACACCTCCTGCAAAGGAAAGG + Intergenic
1173168626 20:40704334-40704356 AGACAAAGGCTCCCAAGGAAAGG + Intergenic
1175854156 20:62111075-62111097 AGACAATTGTTACCAAGGAGTGG + Intergenic
1176137769 20:63532036-63532058 AGACAATCGCTGCCAGGGAATGG - Intronic
1177211370 21:18076108-18076130 AGAGAACTGGTACCAAGAAGTGG + Intronic
1177297687 21:19198322-19198344 TAAAAACTGCTTCCAAGGAAAGG + Intergenic
1178847819 21:36188077-36188099 ATAAAGCTGCTAGCAAGGAATGG - Intronic
1180322786 22:11338403-11338425 AGAAAATTGGCACCAAGGAATGG - Intergenic
1184861687 22:47176292-47176314 AGCCAAGTGCTGCCAAGGGAGGG - Intergenic
1185336698 22:50274089-50274111 AGACCACTACTACCAATGCATGG - Intergenic
953492069 3:43361025-43361047 AGACAGCTGGTCCCAGGGAATGG - Intronic
953699580 3:45185420-45185442 AGAGAGGTGCTGCCAAGGAAGGG + Intergenic
955103463 3:55874170-55874192 AGTCAACTGCCTCCAAGGTATGG - Intronic
955301363 3:57783051-57783073 AGAAAATTGCTACCAAGAAGTGG + Intronic
955415810 3:58689882-58689904 AGGCAACATCTAGCAAGGAAGGG - Intergenic
955603684 3:60675593-60675615 ACATAACTACCACCAAGGAAGGG - Intronic
956290693 3:67656419-67656441 AGACAACTGGAAGCAAGGAGGGG + Intergenic
957866318 3:86028680-86028702 AAACAACTGCTTTAAAGGAAAGG + Intronic
958824160 3:99009644-99009666 AGAAAATTGGTACCAAGGAGTGG - Intergenic
959775774 3:110161324-110161346 AGACAACAGCCAGCAAAGAATGG - Intergenic
960724844 3:120659710-120659732 AGAAAATTGGTACCAAGGAGTGG - Intronic
961179170 3:124862725-124862747 GGAAAACTGCTACCAGTGAAGGG - Intronic
962005430 3:131344541-131344563 AGAAAATTGATACCAAGGAGAGG - Intronic
962161883 3:133009589-133009611 AGAAAATTGGTACCAAGGAATGG + Intergenic
965346781 3:167560851-167560873 AGACAAATGCTAGAAGGGAAAGG + Intronic
967215681 3:187208129-187208151 AGAAAATTGCTACCAAGGAGTGG - Intergenic
967260387 3:187635827-187635849 AGAAAATTGATACCAAGGAGTGG - Intergenic
967458450 3:189717746-189717768 AGAAAACTGCTTTAAAGGAAAGG - Intronic
967592816 3:191298646-191298668 AGAAAATTGGTACCAAGGAGTGG + Intronic
967602533 3:191406461-191406483 AGAAAATTGGTACCAAGGAGTGG - Intergenic
967639820 3:191848525-191848547 AGACTACTACAACAAAGGAAGGG + Intergenic
971642405 4:29152442-29152464 AGACAAATGCAACTGAGGAATGG - Intergenic
972107036 4:35501616-35501638 TGACAACAGAGACCAAGGAATGG - Intergenic
972367682 4:38391726-38391748 AGAAAATTGGTACCAAGGAGTGG + Intergenic
972897897 4:43645526-43645548 AGAAAATTGGTACCAAGGAGTGG - Intergenic
973780527 4:54284337-54284359 AGAAAATTGGTATCAAGGAATGG - Intronic
973927324 4:55751900-55751922 AGACAACAGCTACCATGGTTTGG + Intergenic
973979103 4:56291866-56291888 AGAAAACTGGTACCAAAGAATGG + Intronic
974399282 4:61381051-61381073 AGACAGCTCCAACCAAGGACAGG - Intronic
975095917 4:70456193-70456215 AGAAAATTGATACCAAGGAGCGG - Intronic
975435422 4:74345501-74345523 AGAAAACTGGTACCAAGGTTTGG - Intergenic
975521838 4:75310068-75310090 AGAAAATTGGTACCAAGGAGTGG + Intergenic
976227661 4:82809000-82809022 GGACAATGGCTACCAGGGAAGGG + Intergenic
976798131 4:88957548-88957570 AGAAAATTGGTACCAAGGATGGG + Intronic
977378214 4:96236537-96236559 AGAAAATTGGTACCAAGGAAAGG + Intergenic
978091638 4:104724866-104724888 AAACAACTGCCATCATGGAAGGG + Intergenic
979027492 4:115596145-115596167 AGAAAATTGGTACCAAGGAGTGG + Intergenic
979126025 4:116972477-116972499 AGGTAACTGCAACCATGGAAAGG + Intergenic
979601621 4:122591969-122591991 AGAAAATTGGTACCGAGGAATGG - Intergenic
979969150 4:127113401-127113423 AGAAAACTGGTACCAAAGAGCGG + Intergenic
980441105 4:132845981-132846003 AGAAAACTGGTACCAAGGAGTGG - Intergenic
980767935 4:137332368-137332390 AGAAAATTGGTACCAAGGAATGG - Intergenic
980949207 4:139355590-139355612 TGGCTACTGCAACCAAGGAATGG - Intronic
981240020 4:142466055-142466077 AGAAAATTGGTACCAAGGAATGG + Intronic
981270650 4:142845248-142845270 AAACTACTGCCCCCAAGGAAGGG + Intronic
981545450 4:145888510-145888532 ATCCAACTGCTACCAAGAAATGG - Intronic
983242413 4:165248495-165248517 AGACACGTGCTTCCAAGGAGCGG + Intronic
984116965 4:175694202-175694224 AGAAAACTGGTACCAAAGAGTGG + Intronic
985198819 4:187462754-187462776 AGCAAAGTGCTACCAACGAAGGG + Intergenic
988411500 5:30891852-30891874 ACACAACTGTTACCTAGAAATGG + Intergenic
988671437 5:33385999-33386021 AGAAAATTGGTACCAAGGAGTGG - Intergenic
990494729 5:56335758-56335780 AGAAAATTGGTACCTAGGAATGG - Intergenic
990784792 5:59407451-59407473 AGAAGACTGGTACCAAGGAGTGG + Intronic
990921948 5:60978031-60978053 CCACAGCTGCTACCAGGGAATGG - Intronic
992089418 5:73303936-73303958 AGACCACTGCTCCCACTGAATGG + Intergenic
995862510 5:116656641-116656663 TGGCAACTGCTACGAAGGAGGGG + Intergenic
995900478 5:117060147-117060169 AGAGAACTGCTAAGAAGCAAAGG - Intergenic
996674375 5:126157397-126157419 AGAAAATTGGTACCAAGGAGTGG + Intergenic
997032653 5:130149206-130149228 AGAAAATTGGTACCAAGGAGTGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997308995 5:132864231-132864253 AGACATATGCTACCAAGGAAGGG - Exonic
997498876 5:134355342-134355364 ACACAAGTGCTACAAAGGAAAGG + Intronic
999208989 5:149871355-149871377 AAACAACTGCTCTGAAGGAAAGG + Intronic
999993026 5:157066197-157066219 AGTCAAATGCTGCAAAGGAAAGG + Intergenic
1000600887 5:163273428-163273450 ACACAGCTACTACCAAGAAAGGG + Intergenic
1001820549 5:174706742-174706764 GGACAAGTGCCCCCAAGGAAAGG - Intergenic
1002003073 5:176209299-176209321 AGAAAATTGGTACCAAGGAGTGG - Intergenic
1002223387 5:177701649-177701671 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1003965273 6:11246780-11246802 AGACATCTCTTACAAAGGAAAGG + Intronic
1004308444 6:14522190-14522212 AGCCAACTACTACCAGAGAAAGG - Intergenic
1005228625 6:23672602-23672624 AGAAAACTGGTACCAAGGAGAGG - Intergenic
1005322106 6:24665847-24665869 AGACAAATATTAGCAAGGAAGGG + Intronic
1007274315 6:40662292-40662314 ATACAACCTCTATCAAGGAAAGG - Intergenic
1007993427 6:46281151-46281173 AGGCCACAGCTACCTAGGAATGG + Intronic
1010348372 6:74840408-74840430 AGAAAATTGTTACCAAGGAGTGG + Intergenic
1011245489 6:85317283-85317305 AGAAAATTGGTACCAAGGAATGG + Intergenic
1011968254 6:93187953-93187975 AGACAACTTCTATCAAGTTAAGG + Intergenic
1012597448 6:101056339-101056361 AGAAAATTGGTACCAAGGAGTGG - Intergenic
1012677796 6:102138716-102138738 AGAAAATTGATACCAAGGAGTGG - Intergenic
1013091000 6:106900847-106900869 AGAAAATTGGTACCAAGGAATGG + Intergenic
1013313598 6:108920512-108920534 AGACAGCTCCTTCCTAGGAAAGG - Intronic
1013591724 6:111624286-111624308 AAATAATTGCTACCAAGGAAAGG - Intergenic
1015609604 6:135002179-135002201 AAACAAGTGCTACCAAGGTATGG + Intronic
1015851472 6:137577857-137577879 AGACCACCTCTACCCAGGAAGGG + Intergenic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1020422632 7:8026568-8026590 GCACAACTGCTGCCAGGGAATGG - Intronic
1022842834 7:34181062-34181084 AGACAATTGGTACCAAGAAGAGG + Intergenic
1024228697 7:47347646-47347668 ACACAACAGCGACCAAGCAAGGG + Intronic
1027395354 7:77747757-77747779 AGAAAACTGGTACTGAGGAATGG - Intronic
1027677668 7:81180095-81180117 AGAAAATTGGTACCAAGAAAAGG + Intronic
1027913095 7:84278463-84278485 AGAAAATTGGTACCAAGGAATGG - Intronic
1028581346 7:92412659-92412681 AGAAAACTCCAACAAAGGAATGG + Intergenic
1029215222 7:98943336-98943358 AGACAGCAGCTGCCAAGGACAGG - Intronic
1030002798 7:105083437-105083459 AGACAACAGGTAGCTAGGAAGGG - Intronic
1031625759 7:123991271-123991293 TGACAAGTGCTTCCAAGGACTGG + Intergenic
1033784724 7:144717026-144717048 AGAAAATTGGTACCAAGGAGTGG + Intronic
1035655380 8:1301281-1301303 AGACAGCAGCTTCCATGGAAGGG - Intergenic
1035864836 8:3070824-3070846 AGAAAATTGGTACCAAGGAGTGG - Intronic
1035928063 8:3750864-3750886 GCAGAACTGTTACCAAGGAATGG - Intronic
1035951097 8:4021961-4021983 AGTCAAGTGCTGCCTAGGAAAGG + Intronic
1037313752 8:17581878-17581900 AGAAAATTGGTACCAAGGAGTGG + Intronic
1037732687 8:21541516-21541538 AGAAAATTGCTGCCAAGGAGTGG - Intergenic
1038874655 8:31534902-31534924 TCACAACTGGCACCAAGGAAAGG - Intergenic
1039124484 8:34185839-34185861 AGACATCTGGTTCCAAGGAAAGG + Intergenic
1039315232 8:36364378-36364400 AGACCACTGCCATCAAGGAAGGG + Intergenic
1040932767 8:52752194-52752216 AGACAACTTCTCCCAAGATATGG - Intergenic
1041123855 8:54614564-54614586 AGACAAGTGATACCAGGGAGAGG + Intergenic
1041392438 8:57358981-57359003 AGAAAATTGGTACCTAGGAATGG + Intergenic
1042307705 8:67348684-67348706 AGAAAAATCCTACAAAGGAAAGG + Intergenic
1042386499 8:68181375-68181397 AGACATCTGCTACAGAGGGAAGG - Intronic
1043198996 8:77339476-77339498 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1043788352 8:84431212-84431234 AGACAACTGCAAGGCAGGAAGGG + Intronic
1045219588 8:100185435-100185457 TGACAAGTGCTACAAAGGAGAGG - Intronic
1045574296 8:103402851-103402873 AGACCACAGCTTCCAAGGAATGG + Intronic
1046803875 8:118459037-118459059 AAAAATCTGCTACCCAGGAAAGG + Intronic
1048054390 8:130849495-130849517 AGGTAACTGGTACCAAGGAAGGG + Intronic
1048096553 8:131301451-131301473 AGAAAATTGCTACCAAGAGAAGG - Intergenic
1049256264 8:141615539-141615561 AGACCACTGCTCCCCAGGAGGGG - Intergenic
1050125068 9:2348226-2348248 AGAAAATTGGTACCAAGGAATGG + Intergenic
1050663237 9:7906835-7906857 AAACAACTATAACCAAGGAATGG - Intergenic
1052193307 9:25682940-25682962 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1053452692 9:38206491-38206513 TGACAACTGCTACCAATTACTGG - Intergenic
1053783894 9:41637036-41637058 TGACAACTGCAAGCAAGAAAGGG - Intergenic
1057254409 9:93533372-93533394 GGACAACTATCACCAAGGAAAGG - Intronic
1057642132 9:96834758-96834780 AGAAAATTGGTACCAAGGAGTGG + Intronic
1058502819 9:105638610-105638632 AGACCACTACTACCAGGGAAAGG - Exonic
1203370477 Un_KI270442v1:298983-299005 AGAAAATTGGCACCAAGGAATGG - Intergenic
1185777944 X:2820673-2820695 ATGCAACTGCTACAAAGGCATGG + Intergenic
1186694383 X:12014279-12014301 AGACAACTGCTATCCATGAAGGG + Intergenic
1187541928 X:20205284-20205306 AGAACACTGCTACAAAAGAATGG - Intronic
1187843058 X:23508775-23508797 AGAAAATTGGTACCAAGGAGTGG + Intergenic
1189196943 X:39161060-39161082 AGACAGCTGGGACCAAGGATGGG - Intergenic
1193629037 X:83858749-83858771 CCACAAATGCTACCCAGGAATGG - Intergenic
1193700253 X:84751480-84751502 AGAAAACTCCTTCCAAGGTAAGG + Intergenic
1193986388 X:88245937-88245959 AGCCAACAGCCAGCAAGGAAAGG - Intergenic
1194325984 X:92517197-92517219 AGACAATTGCAACAAAAGAAGGG - Intronic
1195757781 X:108216277-108216299 ATCCAGCTGATACCAAGGAATGG + Intronic
1196170215 X:112579151-112579173 AAACAACTGCTACAAATGAATGG - Intergenic
1197672814 X:129297482-129297504 AGAAATCTGGTACCAAGAAATGG + Intergenic
1199187627 X:144935489-144935511 AGATACCTGATAACAAGGAATGG - Intergenic
1200634704 Y:5636371-5636393 AGACAATTGCAACAAAAGAAGGG - Intronic
1200948135 Y:8866227-8866249 AGACAACTGGTTACAAGAAAAGG + Intergenic
1201067835 Y:10116099-10116121 AGAAAATTGGCACCAAGGAATGG + Intergenic