ID: 1105935439

View in Genome Browser
Species Human (GRCh38)
Location 13:25094314-25094336
Sequence TGCCCATGAACACACCGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105935437_1105935439 10 Left 1105935437 13:25094281-25094303 CCGTGGGCTGTATCTGTGGGGAA 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 68
1105935432_1105935439 24 Left 1105935432 13:25094267-25094289 CCCAAGTGTATATTCCGTGGGCT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 68
1105935429_1105935439 27 Left 1105935429 13:25094264-25094286 CCACCCAAGTGTATATTCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 68
1105935433_1105935439 23 Left 1105935433 13:25094268-25094290 CCAAGTGTATATTCCGTGGGCTG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105935439 Original CRISPR TGCCCATGAACACACCGAAA TGG Intergenic
904379955 1:30103871-30103893 TGCCCATTCACACACTGAAAAGG + Intergenic
904998375 1:34648923-34648945 TGCCAATGAACAAAGCAAAACGG + Intergenic
908457353 1:64316805-64316827 TCACCATGCACACACAGAAATGG - Intergenic
917377166 1:174361443-174361465 TGCCAATGAAAAAACTGAAAAGG - Intronic
919617166 1:199822355-199822377 TGCCCAAGAACACACAGTTAAGG + Intergenic
1065938427 10:30542311-30542333 TTCCCACAAACACACCAAAAGGG - Intergenic
1066311632 10:34202993-34203015 TGCACTTGAACACAACCAAATGG + Intronic
1068555287 10:58452146-58452168 TGCCCATAAGCACACAGAATTGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068939857 10:62670187-62670209 TGCCTATGAAGACAGAGAAAAGG - Exonic
1074032216 10:109700237-109700259 AGACCATGAACCCACCGGAAGGG + Intergenic
1074348621 10:112713051-112713073 TGGCCATGGAAACACAGAAAGGG - Intronic
1075591905 10:123697952-123697974 TGCCCAGGATCACACAGTAAGGG + Intergenic
1079549486 11:21676095-21676117 TGCCCATGAGTACACCAACAAGG + Intergenic
1080245176 11:30171952-30171974 TGCCCAATAACATACAGAAAGGG - Intergenic
1080405465 11:31974906-31974928 TTCCCATGAACACACTTAATTGG + Intronic
1087864086 11:103201708-103201730 TCCCCAGGAAGACACCAAAAAGG - Intronic
1088239712 11:107760517-107760539 AGACCATGAACCCACCGAGAGGG - Intergenic
1093985344 12:25525171-25525193 TACCCATGGACACACCAATAAGG - Intronic
1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG + Intergenic
1107965920 13:45598184-45598206 TGAACAAGAACACACAGAAATGG - Intronic
1110358635 13:74599118-74599140 TGCCCATCAAGACACCCTAAAGG + Intergenic
1113739983 13:112704888-112704910 TGCCCACGAAGACATGGAAATGG + Intronic
1114535679 14:23420794-23420816 TGCCCATGGATACATCCAAAAGG - Intronic
1117150891 14:52886733-52886755 TGCATATAAACACACAGAAACGG + Intronic
1117646554 14:57859324-57859346 TGCCCATGGACACACGCAAGTGG - Intronic
1121503739 14:94460679-94460701 TGCCCATGAAAACACAGAGAGGG - Intergenic
1124711397 15:32015679-32015701 CCCCCATGAACACACAGAAATGG + Intergenic
1127799933 15:62469249-62469271 TGCTCATGAACAGACAGAAATGG - Intronic
1128624451 15:69185504-69185526 TGCCCATGATCACACAGATCTGG - Intronic
1134032424 16:11003229-11003251 TGCCCAAGAAGACGCCGAGAAGG + Exonic
1138242954 16:55443793-55443815 TGCCCCTGAATACACCCAAAAGG - Intronic
1140290043 16:73644795-73644817 TGCCGCAGAACACACAGAAAAGG - Intergenic
1147564141 17:41526356-41526378 TGCACATGCACACACACAAATGG - Intronic
1148331829 17:46818116-46818138 TGCCCATGAAGACCCCAAAATGG + Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151988565 17:77559371-77559393 TGCCCATGAACACATCCAGAGGG - Intergenic
1160734157 19:654218-654240 TGCACATGAACCCACCGTGAGGG + Intronic
1161052271 19:2170795-2170817 TGCCCATGAATACTGAGAAATGG + Intronic
1161353757 19:3807667-3807689 TGCACAAGCACACACCGACATGG - Intronic
926622740 2:15061753-15061775 TTCCCATGAACACACTGACATGG - Intergenic
933698132 2:85235517-85235539 TGCCCATGGTCACACCACAAGGG - Intronic
936456734 2:112680981-112681003 TGCCAAAGCACACACCAAAATGG - Intergenic
937999941 2:127725190-127725212 TGCCCATAAAAACACAGTAATGG - Exonic
938401616 2:130997185-130997207 TCCCCATCAACACACACAAAAGG - Intronic
940788515 2:158007139-158007161 TGCCTATGAGTACACAGAAAGGG - Intronic
940981274 2:160006345-160006367 TGCCTATGAACACACTGATTTGG - Intronic
944375883 2:199041717-199041739 TGCCTATGAACAGACAGAAGAGG - Intergenic
949001660 2:241618023-241618045 TGCCAAGGCACACACAGAAAGGG + Intronic
1175949083 20:62572977-62572999 TGCCCCTGAAGACACAGTAAAGG - Intergenic
1181646442 22:24233762-24233784 GGCCCAAGAACACCCAGAAACGG + Intronic
1183313754 22:37126169-37126191 TGCCCCAGAACACACAGCAAAGG + Exonic
950317663 3:12018882-12018904 TGCCCATGACCATACCTAAAAGG - Intronic
950689645 3:14645875-14645897 TTCCCATGGACACACAGCAAGGG - Intergenic
953388957 3:42523473-42523495 TGCCCATGGTCACACAGCAAGGG - Intronic
955957618 3:64306474-64306496 TGCCCATGCACACACACAGAGGG - Intronic
956188789 3:66588150-66588172 TGTCTATGCACACACTGAAATGG - Intergenic
958943485 3:100338649-100338671 GGCCCATGAACAAACAGTAAGGG + Intronic
963379458 3:144508981-144509003 TGACAATGAACACAGTGAAAGGG + Intergenic
964226048 3:154403598-154403620 TTCCCATGAACACATTGATAGGG + Intronic
967030893 3:185605587-185605609 TGCCAATGAACACAAAGAAAGGG - Intronic
975978481 4:80127060-80127082 TGCCCAAGAATACACAGGAAAGG - Intergenic
984136793 4:175951398-175951420 AGGCCATGAACAGACAGAAAAGG + Intronic
990479316 5:56192995-56193017 TGTTCATGAACATACTGAAAAGG - Intronic
991688333 5:69202497-69202519 TATCCATGAGCACACTGAAAAGG - Exonic
1003482059 6:6543493-6543515 GGGCCATGAACACAGAGAAAAGG - Intergenic
1008792358 6:55252221-55252243 TGCCCTTCATCACACAGAAAAGG - Intronic
1016120716 6:140338768-140338790 TGCCCTTGAGTACACAGAAAAGG + Intergenic
1017444917 6:154499028-154499050 AGCCCAGGAACACACAGAAGGGG - Intronic
1021748414 7:23768181-23768203 TGCCTATGTAAACACAGAAAAGG - Intronic
1022035150 7:26527192-26527214 TGCCCATGAACATATAGAAGAGG - Intergenic
1026166945 7:67918607-67918629 TGCCCATGAAAACCCAGAAATGG - Intergenic
1031111569 7:117616856-117616878 TGCCCATAAACACCCAGGAAAGG - Intronic
1031264051 7:119561041-119561063 TTTCCATAAACACACCTAAAAGG + Intergenic
1035408490 7:158617845-158617867 GGGCCATGAACACAGCGAGAAGG + Intergenic
1040733283 8:50475531-50475553 TGCGAAGGAACACACGGAAATGG - Intronic
1041243548 8:55870121-55870143 TGCCCATGAACACATGGGCAGGG - Intergenic
1043552875 8:81394603-81394625 GGTCCATGAAGACACTGAAATGG + Intergenic
1048493951 8:134920080-134920102 TGCCCATGAATACAGTGAGATGG + Intergenic
1188149772 X:26657609-26657631 TGACAATGAACACTCTGAAAAGG - Intergenic