ID: 1105937934

View in Genome Browser
Species Human (GRCh38)
Location 13:25119102-25119124
Sequence CTGAGCGAGCTCGTGGGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105937934 Original CRISPR CTGAGCGAGCTCGTGGGCGT CGG (reversed) Intergenic
902830588 1:19009885-19009907 CTGAGAGAGCTTGTGGCCTTGGG + Intergenic
903135515 1:21307033-21307055 CTGAGCCAACTCTTGGGCTTAGG + Intronic
903222291 1:21875634-21875656 CTCAGCGGGCTGCTGGGCGTAGG + Exonic
1063592659 10:7408598-7408620 CCGAGGGACCTCGTGGGCGGGGG - Intronic
1070152100 10:73811429-73811451 CTGAGCGCGACCGTGGGCGGGGG + Intronic
1072690251 10:97568082-97568104 CTGGGCCAGCTCGTGGTCGTTGG - Exonic
1075110084 10:119572312-119572334 CTGGGCGTGCTGGTGGGCGCTGG - Exonic
1075700352 10:124465257-124465279 CTTGGCGAGTTCGAGGGCGTGGG + Intronic
1078237406 11:9498333-9498355 CTGAGAGAGCTCGTGGTCTAGGG - Intronic
1083861619 11:65423100-65423122 CTGAGCGAGCCCGGGTGCGCTGG + Intergenic
1083879495 11:65540995-65541017 CTGAGCGCGCGCGTGGGCTTAGG + Intronic
1085879477 11:80448916-80448938 CTGAGTGAGCTCTTGGGTGGAGG - Intergenic
1100810127 12:98329605-98329627 CTGAGTGAGCACGTGAGAGTAGG - Intergenic
1105652192 13:22391340-22391362 CTGGGGGAGCAGGTGGGCGTAGG - Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1113451711 13:110414578-110414600 CTGAGAGAGATCGGGGGGGTCGG - Intronic
1113994072 14:16052768-16052790 CTGAGGGAGCTCGTTGGTGTAGG + Intergenic
1130540461 15:84817691-84817713 CTGAGAGGGCTCGAGGGCGCAGG - Intronic
1131049202 15:89335008-89335030 CCGAGCTAGCTGGTGGGCGGAGG + Intergenic
1134031888 16:10998727-10998749 CTGAGTGAGCTCATGGCTGTAGG - Intronic
1134666681 16:16023888-16023910 TTGAGGGAGCTTGTGGGTGTTGG + Intronic
1141538539 16:84700198-84700220 CGGAGCGAGCGTGTGGGAGTGGG + Intronic
1142010418 16:87711114-87711136 TTGAGAGAGCTCATGGGCTTTGG + Intronic
1150003628 17:61456570-61456592 CAGCGCGGGCTCGGGGGCGTTGG - Exonic
1157617888 18:48998198-48998220 CTGAGAGGGGACGTGGGCGTGGG + Intergenic
1162833878 19:13303546-13303568 CTTGGTGAGCTCCTGGGCGTTGG + Exonic
1163398175 19:17076081-17076103 GTGAGGGAGTTCGAGGGCGTGGG + Intronic
1166042909 19:40214026-40214048 CTGGGCGAGGGCGTGGGTGTGGG - Exonic
930056698 2:47257811-47257833 CTGAGAGAGGTCGTGGGGGTGGG + Intergenic
931241873 2:60461302-60461324 CGGGGCGCGGTCGTGGGCGTGGG - Exonic
938537590 2:132258102-132258124 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
945062881 2:205924200-205924222 GAGAGCGAGCTCCTGGGCCTGGG + Intergenic
948301196 2:236908772-236908794 CTGAGTGAGCCCGTGGGAGCAGG - Intergenic
1170886093 20:20340845-20340867 CTGATCCAGCGAGTGGGCGTGGG + Intronic
1171567675 20:26209362-26209384 CTGAGGGAGCTCGTCGGTGTGGG - Intergenic
1171768353 20:29302043-29302065 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
1171811056 20:29744290-29744312 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
1171866502 20:30489885-30489907 CTGAGGGAGCTCGTTGGTGTGGG - Intergenic
1176547146 21:8206922-8206944 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176555051 21:8251131-8251153 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176566097 21:8389969-8389991 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1176573973 21:8434155-8434177 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1180313196 22:11254747-11254769 CTGAGGGAGCTCGTTGGTGTAGG - Intergenic
1180342052 22:11627618-11627640 CTGAGGGAGCTCGTTGGTGTGGG + Intergenic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG + Intronic
1184629392 22:45763842-45763864 CTGAGTGAGCTGGTGAGCATGGG + Intronic
1185055465 22:48576440-48576462 CTGCGCGACTTCGGGGGCGTCGG + Intronic
1203240422 22_KI270733v1_random:11687-11709 TTGAGAGTGCTCGTGGGGGTGGG + Intergenic
1203252021 22_KI270733v1_random:123207-123229 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203260075 22_KI270733v1_random:168290-168312 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
956144433 3:66178038-66178060 CTGAGACAGCTCGTGGGAATTGG + Intronic
959683103 3:109118138-109118160 CTGCGCGTGAGCGTGGGCGTGGG - Exonic
962275295 3:134008728-134008750 CTGAGCCAGCCCCTGGGAGTGGG + Intronic
967088124 3:186112190-186112212 CTGAGCCAGCTCCTGGGCCCAGG + Intronic
968571930 4:1346658-1346680 CGGGGCGAGCTCGGGGGCGGGGG + Intergenic
968591070 4:1459928-1459950 CTGAGGGAGATCCTGGGTGTCGG + Intergenic
973183323 4:47294478-47294500 ATGAGCGAGACTGTGGGCGTAGG - Intronic
989009590 5:36855239-36855261 CTGAGAGAGCACGTGGGACTTGG + Intergenic
990030278 5:51251103-51251125 CAGTGAGAGTTCGTGGGCGTAGG - Intergenic
1007359552 6:41345334-41345356 CAGAGAGAGCTGGTGGGAGTGGG - Intronic
1017121187 6:151025248-151025270 CTGAGCAGGCTCGTGGACGTCGG + Intronic
1017146797 6:151241391-151241413 CTGAGCGAACGCGAGGGCGCTGG - Intronic
1021217840 7:17939851-17939873 CTGACCGAGCTCGGAGGCGGAGG + Intronic
1023096816 7:36669809-36669831 CTCAGAGAGCTCCTGGGCTTAGG + Intronic
1035267957 7:157702511-157702533 CTGAGCCAGCCAGTGAGCGTGGG - Intronic
1049805642 8:144537563-144537585 CTGAGCGAGCTGGAGGGCCCAGG - Intronic
1051091982 9:13420545-13420567 CTGAGGGAGTTTGTGGGCATTGG - Intergenic
1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG + Intergenic
1054258360 9:62838039-62838061 CTGAGGGAGATCGGGGCCGTTGG + Intergenic
1054333409 9:63782002-63782024 CTGAGGGAGATCGGGGCCGTTGG - Intergenic
1062367309 9:136216985-136217007 CGGAGCGAGGCCGTGGGCGCAGG - Intronic
1202800414 9_KI270719v1_random:170336-170358 CTGAGGGAGATCGGGGCCGTTGG - Intergenic
1203468424 Un_GL000220v1:106357-106379 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203476245 Un_GL000220v1:150329-150351 CTGAGGGAGCTCGTCGGTGTGGG + Intergenic
1203361689 Un_KI270442v1:222207-222229 CTGAGGGAGCTCATTGGTGTGGG - Intergenic
1186274149 X:7921800-7921822 CTGGGCCAGCTCGTGAGCGCTGG + Exonic
1201076752 Y:10195349-10195371 CTAAGGGAGCTCGTTGGTGTGGG + Intergenic