ID: 1105939935

View in Genome Browser
Species Human (GRCh38)
Location 13:25138832-25138854
Sequence CGCCTGTAATCCCAGCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 519163
Summary {0: 13, 1: 1322, 2: 29431, 3: 166292, 4: 322105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105939935_1105939944 23 Left 1105939935 13:25138832-25138854 CCGGGCAGCTGGGATTACAGGCG 0: 13
1: 1322
2: 29431
3: 166292
4: 322105
Right 1105939944 13:25138878-25138900 TCTGTGTTTTTAGTAGAGATGGG 0: 44
1: 5266
2: 101853
3: 249405
4: 160689
1105939935_1105939945 24 Left 1105939935 13:25138832-25138854 CCGGGCAGCTGGGATTACAGGCG 0: 13
1: 1322
2: 29431
3: 166292
4: 322105
Right 1105939945 13:25138879-25138901 CTGTGTTTTTAGTAGAGATGGGG 0: 48
1: 4986
2: 93310
3: 182047
4: 180271
1105939935_1105939943 22 Left 1105939935 13:25138832-25138854 CCGGGCAGCTGGGATTACAGGCG 0: 13
1: 1322
2: 29431
3: 166292
4: 322105
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939935_1105939936 -7 Left 1105939935 13:25138832-25138854 CCGGGCAGCTGGGATTACAGGCG 0: 13
1: 1322
2: 29431
3: 166292
4: 322105
Right 1105939936 13:25138848-25138870 ACAGGCGCCCACCACCACACTGG 0: 43
1: 303
2: 996
3: 1980
4: 3530
1105939935_1105939937 -6 Left 1105939935 13:25138832-25138854 CCGGGCAGCTGGGATTACAGGCG 0: 13
1: 1322
2: 29431
3: 166292
4: 322105
Right 1105939937 13:25138849-25138871 CAGGCGCCCACCACCACACTGGG 0: 90
1: 2287
2: 13991
3: 42318
4: 79473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105939935 Original CRISPR CGCCTGTAATCCCAGCTGCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr