ID: 1105939939

View in Genome Browser
Species Human (GRCh38)
Location 13:25138856-25138878
Sequence AGATTGGCCCAGTGTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17287
Summary {0: 2, 1: 2, 2: 80, 3: 1184, 4: 16019}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105939939_1105939945 0 Left 1105939939 13:25138856-25138878 CCACCACCACACTGGGCCAATCT 0: 2
1: 2
2: 80
3: 1184
4: 16019
Right 1105939945 13:25138879-25138901 CTGTGTTTTTAGTAGAGATGGGG 0: 48
1: 4986
2: 93310
3: 182047
4: 180271
1105939939_1105939943 -2 Left 1105939939 13:25138856-25138878 CCACCACCACACTGGGCCAATCT 0: 2
1: 2
2: 80
3: 1184
4: 16019
Right 1105939943 13:25138877-25138899 CTCTGTGTTTTTAGTAGAGATGG 0: 1
1: 190
2: 12563
3: 210854
4: 144958
1105939939_1105939946 14 Left 1105939939 13:25138856-25138878 CCACCACCACACTGGGCCAATCT 0: 2
1: 2
2: 80
3: 1184
4: 16019
Right 1105939946 13:25138893-25138915 GAGATGGGGTTTCACCATGTCGG 0: 39926
1: 95780
2: 131152
3: 108291
4: 62548
1105939939_1105939947 23 Left 1105939939 13:25138856-25138878 CCACCACCACACTGGGCCAATCT 0: 2
1: 2
2: 80
3: 1184
4: 16019
Right 1105939947 13:25138902-25138924 TTTCACCATGTCGGCCAAGCTGG 0: 26
1: 3952
2: 97691
3: 165973
4: 177042
1105939939_1105939944 -1 Left 1105939939 13:25138856-25138878 CCACCACCACACTGGGCCAATCT 0: 2
1: 2
2: 80
3: 1184
4: 16019
Right 1105939944 13:25138878-25138900 TCTGTGTTTTTAGTAGAGATGGG 0: 44
1: 5266
2: 101853
3: 249405
4: 160689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105939939 Original CRISPR AGATTGGCCCAGTGTGGTGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr